Anodonta kennerlyi

I.Lea, 1860 · species

image placeholder — illustration coming later

Animalia/Mollusca/Bivalvia/Unionida/Unionidae/Anodonta

At a glance

Occurrence records475

Data sources3

Biological traits2

DNA specimens11

eDNA detections0

Sources3 archives

Databases and archives Anodonta kennerlyi's data was compiled from.

GBIFGlobal Biodiversity Information Facility475 records↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF475 records

DNA & barcodingBOLD11 specimens

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthic

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anodonta kennerlyi has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

TACTTTATATTTATTATTGGCTTTGTGGTCTGGTTTAATTGGGTTAGCTTTGAGGCTTTTGATTCGAGCTGAGTTGGGTCAACCAGGAAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pseudanodonta complanatasame family9.5%Lasmigona decoratasame family10.6%Lanceolaria eucylindricasame family10.9%Alasmidonta triangulatasame family11.1%Strophitus undulatussame family11.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type475 records

Wild obs. + sensor256

Museum / vouchered219

Range

Area of Occupancy AOO1 372 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 159≤1 km 23≤10 km 8>10 km 5

195 georeferenced · 61 without coordinates

Open the mapobservation + sensor256

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤1 km 3≤10 km 3>10 km 1

7 georeferenced · 212 without coordinates

Open the institutions mapphysical evidence219

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	102
Victoria, CA	49
Ann Arbor, US	18
The Ohio State University Museum of Biological Diversitylocation not on record	15
Champaign, US	10
Philadelphia, US	4
Washington, US	4
Delaware Museum of Nature and Sciencelocation not on record	3
Cambridge, US	2
North Carolina Museum of Natural Scienceslocation not on record	2
Los Angeles, US	2
Edmonton, CA	2
Chongqing Museumlocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Alabama Museum of Natural Historylocation not on record	1
Saint John, CA	1

16 institutions · 218 of 219 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)