Anisota assimilis

Druce, 1886 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Saturniidae/Anisota

At a glance

Occurrence records121

Data sources6

Biological traits0

DNA specimens11

eDNA detections11

Sources6 archives

Databases and archives Anisota assimilis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility121 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF121 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD11 specimens

01Narrative

Anisota assimilis est une espèce de lépidoptères (papillons) de la famille des Saturniidae, de la sous-famille des Ceratocampinae originaire de Belize et du Mexique.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anisota assimilis has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections11

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

274Cmostly conserved

313Cmostly conserved

346Cmostly conserved

389Gmostly conserved

400Tmostly conserved

403Cmostly conserved

483Cmostly conserved

514Amostly conserved

550Tmostly conserved

562Amostly conserved

571Tmostly conserved

604Tvariable

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCAGAATTAGGTACCCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.48%

Haplotypes3

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anisota disjaliscanasame genus2.0%Anisota dissimilissame genus3.0%Anisota senatoriasame genus4.3%Anisota finlaysonisame genus4.3%Anisota virginiensissame genus4.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type121 records

Wild obs. + sensor5

Museum / vouchered112

Other4

Range

Area of Occupancy AOO52 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 1

3 georeferenced · 2 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 111

111 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence112

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Facultad de Ciencias Biológicas y Agropecuarias, Universidad de Colimalocation not on record	103
Mexico City, MX	8

2 institutions · 111 of 112 vouchered records shown · 1 without an institution code

09Environmental DNA11 detections

Where the DNA of Anisota assimilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.2 °C 19.8–22.1

Seasonal swing summer↔winter13.7 °C

Max temp (day)26.9 °C 26.2–27.1

Min temp (night)16.1 °C 14.5–17.9

Precipitation371 mm/mo 300–399

Air humidity60.2 % 59.1–67.3

Moisture balance210 mm/mo 139–253

Vapour deficit919 Pa 831–1,028

Wind speed1.20 m/s 1.10–1.40

Cloud cover23.5 % 22.6–25.8

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)