Anisota senatoria

J.E.Smith, 1797 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Saturniidae/Anisota

At a glance

Occurrence records1 999

Data sources6

Biological traits0

DNA specimens82

eDNA detections0

Sources6 archives

Databases and archives Anisota senatoria's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 999 records↗

BOLD SystemsCentre for Biodiversity Genomics82 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 999 records

DNA & barcodingBOLD82 specimens

01Narrative

Anisota senatoria, the orangestriped oakworm, also known as the orange-tipped oakworm, is a Nearctic moth of the family Saturniidae and subfamily Ceratocampinae. It is one of the more common Saturniids, reaching pest status occasionally in the northern parts of its range. As they are late-season feeders, however, they do little lasting damage to their hosts (most of the energy has been stored already). It is very similar to A. finlaysoni in southern Ontario and A. peigleri in the southern US. The species was first described by James Edward Smith in 1797.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding82 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anisota senatoria has left across the world's sequence archives.

At a glance

DNA specimens82

BINs2

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus81 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

22Amostly conserved

86Gmostly conserved

115Tmostly conserved

127Gmostly conserved

139Cmostly conserved

197Cmostly conserved

208Gmostly conserved

220Tmostly conserved

286Tmostly conserved

307Tmostly conserved

313Cmostly conserved

403Gmostly conserved

505Tmostly conserved

574Cmostly conserved

625Gmostly conserved

631Amostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCAGAATTAGGTACCCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.80%

Haplotypes5

BINs2

Most divergent pair2.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anisota virginiensissame genus1.5%Anisota stigmasame genus1.7%Anisota consularissame genus2.4%Anisota kendallorumsame genus2.9%Anisota dissimilissame genus3.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 999 records

Wild obs. + sensor1 721

Museum / vouchered278

Range

Area of Occupancy AOO5 080 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 1 019≤1 km 190≤10 km 97>10 km 129

1 435 georeferenced · 286 without coordinates

Open the mapobservation + sensor1 721

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤100 m 8≤1 km 47≤10 km 146>10 km 41

242 georeferenced · 36 without coordinates

Open the institutions mapphysical evidence278

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	99
East Lansing, US	64
Cambridge, US	48
Cornell University Insect Collectionlocation not on record	13
Cleveland Museum of Natural History, OH (CLEV)location not on record	10
Denver, US	9
Colorado State Universitylocation not on record	8
Philadelphia, US	6
St. Paul, US	5
UDlocation not on record	4
Universidad Católica de Manizaleslocation not on record	4
Zürich, CH	3
Mississippi State, US	3
Centre for Biodiversity Genomicslocation not on record	1
Toronto, CA	1

15 institutions · 278 of 278 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anisota senatoria

At a glance

Sources6 archives

At a glance

Record type1 999 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 15 geolocated

Record type1 999 records