Anisoneura aluco

(Fabricius, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Anisoneura

At a glance

Occurrence records144

Data sources6

Biological traits0

DNA specimens13

eDNA detections15

Sources6 archives

Databases and archives Anisoneura aluco's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility144 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF144 records

Environmental DNA1 datasets · 8 countries15 detections

DNA & barcodingBOLD13 specimens

01Narrative

Anisoneura aluco is een vlinder uit de familie van de spinneruilen (Erebidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1775 door Fabricius.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anisoneura aluco has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections15

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

19Cmostly conserved

38Gmostly conserved

340Tmostly conserved

448Tmostly conserved

460Cmostly conserved

547Tvariable

604Cmostly conserved

AACTTTATATTTTATTTTCGGAATCTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.26%

Haplotypes4

BIN1

Most divergent pair0.46%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Achaea trapezoidessame family5.9%Erebus macropssame family6.1%Gondysia similissame family6.5%Achaea catocaloidessame family6.7%Catocala epionesame family6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type144 records

Wild obs. + sensor123

Museum / vouchered21

Range

Area of Occupancy AOO432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 34≤1 km 24≤10 km 9>10 km 10

77 georeferenced · 46 without coordinates

Open the mapobservation + sensor123

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
tesrilocation not on record	5
Helsinki, FI	4
Zürich, CH	2
FACTlocation not on record	2
Taiwan Forestry Research Institutelocation not on record	2
National Institute of Biological Resourceslocation not on record	1
ZSMlocation not on record	1
Provincia di Livornolocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

9 institutions · 19 of 21 vouchered records shown · 2 without an institution code

09Environmental DNA15 detections

Where the DNA of Anisoneura aluco was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map8 countries0

1. Forest & Woodland1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.5 °C 24.6–27.3

Seasonal swing summer↔winter1.80 °C

Max temp (day)28.6 °C 26.9–29.4

Min temp (night)22.5 °C 20.4–24.8

Precipitation213 mm/mo 18.3–345

Air humidity65.4 % 63.3–70.2

Moisture balance86.1 mm/mo -110–295

Vapour deficit1,095 Pa 938–1,238

Wind speed1.80 m/s 1.00–3.60

Cloud cover40.5 % 15.5–73.0

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)