Anisodactylus similis

LeConte, 1851 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Anisodactylus

At a glance

Occurrence records668

Data sources7

Biological traits0

DNA specimens35

eDNA detections26

Sources7 archives

Databases and archives Anisodactylus similis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility668 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF668 records

Environmental DNA1 datasets · 1 countries26 detections

DNA & barcodingBOLD35 specimens

01Narrative

Anisodactylus similis is a species of ground beetle in the family Carabidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anisodactylus similis has left across the world's sequence archives.

At a glance

DNA specimens35

BINs1

Marker genes1

eDNA detections26

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

118Tmostly conserved

271Tmostly conserved

340Cvariable

370Amostly conserved

550Amostly conserved

580Gmostly conserved

628Amostly conserved

AACATTATATTTTATTTTTGGAGCATGATCAGGAATAGTAGGGACTTCTTTAAGCATATTAATTCGAGCTGAATTAGGAACTCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.49%

Haplotypes13

BIN1

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anisodactylus binotatussame genus3.8%Anisodactylus nigritasame genus4.4%Anisodactylus melanopussame genus4.5%Anisodactylus punctatipennissame genus4.6%Anisodactylus sanctaecrucissame genus4.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type668 records

Wild obs. + sensor16

Museum / vouchered652

Range

Area of Occupancy AOO556 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 9≤1 km 1≤10 km 3>10 km 1

14 georeferenced · 2 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 256≤1 km 12≤10 km 105>10 km 27

400 georeferenced · 252 without coordinates

Open the institutions mapphysical evidence652

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	265
San Francisco, US	145
San Diego, US	98
Santa Barbara Museum of Natural Historylocation not on record	54
University of Alberta Museums (UAM)location not on record	25
Provo, US	15
University of Alabamalocation not on record	15
OSUClocation not on record	11
NEON Biorepository at Arizona State Universitylocation not on record	7
UDlocation not on record	6
Chicago, US	5
EWIClocation not on record	2
Cambridge, US	1
Colorado State Universitylocation not on record	1
US	1
Champaign, US	1

16 institutions · 652 of 652 vouchered records shown

09Environmental DNA26 detections

Where the DNA of Anisodactylus similis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found26

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 26 detections have coordinates

Open the map1 country0

shrubScrubevergreenForestgrasslandHerbaceous

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 10.5–19.1

Seasonal swing summer↔winter18.6 °C

Max temp (day)21.2 °C 16.9–25.9

Min temp (night)7.40 °C 3.40–11.6

Precipitation28.7 mm/mo 9.60–97.9

Air humidity49.3 % 44.0–56.0

Moisture balance-79.3 mm/mo -161–2.20

Vapour deficit806 Pa 602–1,240

Wind speed1.50 m/s 1.10–2.40

Cloud cover30.4 % 12.1–38.7

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)