Anisodactylus sanctaecrucis

(Fabricius, 1798) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Anisodactylus

At a glance

Occurrence records1 012

Data sources6

Biological traits0

DNA specimens19

eDNA detections1

Sources6 archives

Databases and archives Anisodactylus sanctaecrucis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 012 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 012 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD19 specimens

01Narrative

Anisodactylus sanctaecrucis is a species of ground beetle in the family Carabidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anisodactylus sanctaecrucis has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

235Tmostly conserved

256Tmostly conserved

340Cmostly conserved

415Amostly conserved

421Cmostly conserved

628Amostly conserved

634Cmostly conserved

655Tmostly conserved

AACATTATATTTTATTTTTGGAGCATGATCAGGAATAGTAGGAACTTCTTTAAGCATATTAATTCGAGCTGAATTAGGAACTCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.22%

Haplotypes6

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anisodactylus discoideussame genus1.7%Anisodactylus binotatussame genus3.8%Anisodactylus melanopussame genus4.2%Anisodactylus verticalissame genus4.4%Anisodactylus nigritasame genus4.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 012 records

Wild obs. + sensor265

Museum / vouchered747

Range

Area of Occupancy AOO2 012 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 142≤1 km 48≤10 km 10>10 km 27

227 georeferenced · 38 without coordinates

Open the mapobservation + sensor265

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 50≤1 km 8≤10 km 198>10 km 28

284 georeferenced · 463 without coordinates

Open the institutions mapphysical evidence747

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WIlocation not on record	229
University of Alberta Museums (UAM)location not on record	67
Espace pour la vielocation not on record	67
OSUClocation not on record	53
Champaign, US	47
Royal Saskatchewan Museumlocation not on record	43
Decorah, US	35
University Park, US	30
Tempe, US	28
Provo, US	10
Saint John, CA	10
Lexington, US	9
UDlocation not on record	7
University of Alabamalocation not on record	5
CUlocation not on record	4
Colorado State Universitylocation not on record	4
US	3
Chicago, US	3
EWIClocation not on record	3
University of Guelphlocation not on record	2
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
Lubbock, US	1
NEON Biorepository at Arizona State Universitylocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Universidad Católica de Manizaleslocation not on record	1
Cambridge, US	1

26 institutions · 665 of 747 vouchered records shown · 81 without an institution code

09Environmental DNA1 detections

Where the DNA of Anisodactylus sanctaecrucis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–12.5

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C

Min temp (night)8.20 °C

Precipitation79.6 mm/mo

Air humidity57.3 %

Moisture balance-38.4 mm/mo

Vapour deficit733 Pa

Wind speed5.80 m/s

Cloud cover36.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anisodactylus sanctaecrucis

At a glance

Sources6 archives

At a glance

Record type1 012 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 012 records