Anisodactylus carbonarius

(Say, 1823) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Anisodactylus

At a glance

Occurrence records375

Data sources5

Biological traits0

DNA specimens49

eDNA detections47

Sources5 archives

Databases and archives Anisodactylus carbonarius's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility375 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI47 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics49 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF375 records

Environmental DNA1 datasets · 2 countries47 detections

DNA & barcodingBOLD49 specimens

01Narrative

Anisodactylus carbonarius is een keversoort uit de familie van de loopkevers (Carabidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1823 door Say.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding49 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anisodactylus carbonarius has left across the world's sequence archives.

At a glance

DNA specimens49

BINs1

Marker genes1

eDNA detections47

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus47 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

34Avariable

316Avariable

364Cmostly conserved

463Cmostly conserved

466Amostly conserved

535Amostly conserved

586Avariable

613Tvariable

634Tmostly conserved

637Amostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGAGCATGATCAGGAATAGTAGGAACTTCTTTAAGCATATTAATTCGAGCTGAATTAGGAACTCCTGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.61%

Haplotypes26

BIN1

Most divergent pair1.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anisodactylus binotatussame genus4.1%Anisodactylus furvussame genus4.4%Anisodactylus californicussame genus4.6%Anisodactylus agricolasame genus5.0%Anisodactylus poeciloidessame genus5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type375 records

Wild obs. + sensor1

Museum / vouchered374

Range

Area of Occupancy AOO152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 259≤10 km 39>10 km 4

302 georeferenced · 72 without coordinates

Open the institutions mapphysical evidence374

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	249
Essig Museum of Entomologylocation not on record	49
University Park, US	19
Colorado State Universitylocation not on record	11
OSUClocation not on record	9
University of Alberta Museums (UAM)location not on record	9
Lexington, US	5
UDlocation not on record	5
University of Alabamalocation not on record	3
Chicago, US	2
Provo, US	2
CUlocation not on record	1
Cambridge, US	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
Champaign, US	1

15 institutions · 367 of 374 vouchered records shown · 7 without an institution code

09Environmental DNA47 detections

Where the DNA of Anisodactylus carbonarius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found47

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 47 detections have coordinates

Open the map2 countries0

cultivatedCropsevergreenForestgrasslandHerbaceous

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.0 °C 13.7–23.2

Seasonal swing summer↔winter26.1 °C

Max temp (day)29.5 °C 20.6–31.0

Min temp (night)16.1 °C 8.10–17.0

Precipitation76.6 mm/mo 55.0–76.6

Air humidity50.6 % 50.6–52.1

Moisture balance-113 mm/mo -122–-72.2

Vapour deficit1,271 Pa 725–1,415

Wind speed4.50 m/s 4.40–5.20

Cloud cover22.0 % 21.5–39.2

CHELSA 1981–2010, ~9 km grid, at location & month of 47 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)