Animomyia smithii

(Pearsall, 1910) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Animomyia

At a glance

Occurrence records38

Data sources8

Biological traits0

DNA specimens11

eDNA detections6

Sources8 archives

Databases and archives Animomyia smithii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility38 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF38 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD11 specimens

01Narrative

Animomyia smithii is a species of geometrid moth in the family Geometridae. It is found in North America. The MONA or Hodges number for Animomyia smithii is 6788.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Animomyia smithii has left across the world's sequence archives.

At a glance

DNA specimens11

BINs3

Marker genes4

eDNA detections6

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 44 variable positions, in barcode order

19Cvariable

28Amostly conserved

46Cvariable

49Cmostly conserved

59Tmostly conserved

76Avariable

79Cvariable

82Cvariable

88Tvariable

133Tvariable

136Tvariable

163Amostly conserved

169Avariable

190Tmostly conserved

206Tvariable

217Amostly conserved

265Avariable

271Cvariable

274Tmostly conserved

310Avariable

325Tmostly conserved

340Cmostly conserved

343Cvariable

346Cvariable

347Cvariable

382Tvariable

397Cvariable

400Cvariable

403Avariable

412Avariable

421Cvariable

427Tvariable

433Gmostly conserved

457Cvariable

487Tmostly conserved

508Avariable

553Avariable

571Cvariable

601Tvariable

616Cvariable

637Tmostly conserved

641Cvariable

646Cmostly conserved

649Avariable

AACATTATATTTTATTTTCGGAATTTGAGCAGGTATATTAGGAACCTCCTTAAGATTATTAATTCGAGCAGAATTAGGCACCCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.2%

Haplotypes5

BINs3

Most divergent pair5.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Animomyia minutasame genus7.1%Synopsidia phasidariasame family8.4%Phragmatobia placidasame order8.8%Crocypus perlucidariasame family8.8%Kunugia latipennissame order9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S28S

animal barcoderibosomalmarker

08Occurrence & distribution

Record type38 records

Wild obs. + sensor15

Museum / vouchered23

Range

Area of Occupancy AOO88 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 9≤1 km 1>10 km 4

14 georeferenced · 1 without coordinates

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 2≤10 km 4>10 km 3

9 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	12
ASUlocation not on record	4
New Haven, US	3
San Diego, US	2
Cambridge, US	1
Georgia Museum of Natural Historylocation not on record	1

6 institutions · 23 of 23 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Animomyia smithii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

Sonoran desert

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.4 °C 21.4–31.3

Seasonal swing summer↔winter23.8 °C

Max temp (day)29.7 °C 28.5–38.0

Min temp (night)14.9 °C 13.0–23.6

Precipitation9.80 mm/mo 7.10–12.7

Air humidity38.5 % 37.4–38.9

Moisture balance-170 mm/mo -197–-150

Vapour deficit1,686 Pa 1,574–2,920

Wind speed3.00 m/s 2.90–3.40

Cloud cover25.8 % 15.8–34.2

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)