Kunugia latipennis

(Walker, 1855) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lasiocampidae/Kunugia

At a glance

Occurrence records37

Data sources7

Biological traits0

DNA specimens30

eDNA detections7

Sources7 archives

Databases and archives Kunugia latipennis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility37 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF37 records

Environmental DNA1 datasets · 3 countries7 detections

DNA & barcodingBOLD30 specimens

01Narrative

Kunugia latipennis, the pine lappet moth, is a moth of the family Lasiocampidae. The species was first described by Francis Walker in 1855.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Kunugia latipennis has left across the world's sequence archives.

At a glance

DNA specimens30

BINs11

Marker genes1

eDNA detections7

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Where individuals differ — all 108 variable positions, in barcode order

4Tmostly conserved

7Amostly conserved

13Tvariable

31Tvariable

34Amostly conserved

59Tmostly conserved

67Amostly conserved

70Tmostly conserved

79Tmostly conserved

82Cvariable

83Cmostly conserved

85Tmostly conserved

86Amostly conserved

91Tmostly conserved

115Tmostly conserved

118Tmostly conserved

127Tmostly conserved

136Tmostly conserved

157Tmostly conserved

178Tmostly conserved

181Amostly conserved

184Amostly conserved

190Tmostly conserved

193Tvariable

202Amostly conserved

205Tmostly conserved

206Tvariable

208Amostly conserved

220Tvariable

223Tmostly conserved

232Tmostly conserved

235Cvariable

238Amostly conserved

241Amostly conserved

247Tmostly conserved

259Tmostly conserved

266Tmostly conserved

271Tvariable

274Cvariable

277Tvariable

280Tmostly conserved

283Cvariable

284Cvariable

287Tvariable

292Tvariable

295Amostly conserved

319Tmostly conserved

334Tvariable

340Cvariable

343Avariable

346Tmostly conserved

352Amostly conserved

355Avariable

358Tmostly conserved

362Gmostly conserved

364Tmostly conserved

367Tmostly conserved

368Amostly conserved

373Tmostly conserved

376Amostly conserved

379Tmostly conserved

382Tmostly conserved

385Tmostly conserved

394Tmostly conserved

397Tmostly conserved

400Cvariable

401Cmostly conserved

403Tmostly conserved

406Tmostly conserved

421Tvariable

424Amostly conserved

427Tmostly conserved

433Amostly conserved

442Tmostly conserved

448Tmostly conserved

451Amostly conserved

459Tmostly conserved

478Tmostly conserved

481Amostly conserved

484Tvariable

490Tmostly conserved

508Amostly conserved

511Amostly conserved

538Tmostly conserved

539Tvariable

541Amostly conserved

542Tmostly conserved

547Tvariable

548Tmostly conserved

550Amostly conserved

553Tvariable

556Amostly conserved

562Amostly conserved

571Tmostly conserved

574Tvariable

578Tmostly conserved

580Amostly conserved

586Amostly conserved

595Tvariable

616Cvariable

625Amostly conserved

628Avariable

637Amostly conserved

640Tvariable

646Tvariable

652Tvariable

653Tvariable

658Cvariable

AACTTTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGTACCCCTAGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.7%

Haplotypes18

BINs11

Most divergent pair9.9%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Kunugia placidasame genus5.0%Dendrolimus bazarovisame family5.8%Psilogaster lotisame family6.0%Dendrolimus griseasame family6.1%Dendrolimus angulatasame family6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type37 records

Wild obs. + sensor31

Museum / vouchered6

Range

Area of Occupancy AOO100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 7≤1 km 13≤10 km 1>10 km 1

22 georeferenced · 9 without coordinates

Open the mapobservation + sensor31

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Provincia di Livornolocation not on record	3
Research Collection of Eric Van Schaycklocation not on record	2

2 institutions · 5 of 6 vouchered records shown · 1 without an institution code

09Environmental DNA7 detections

Where the DNA of Kunugia latipennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.6 °C 16.1–26.9

Seasonal swing summer↔winter1.60 °C

Max temp (day)26.2 °C 19.6–31.1

Min temp (night)18.4 °C 11.8–22.3

Precipitation159 mm/mo 53.9–210

Air humidity65.8 % 60.9–68.2

Moisture balance3.70 mm/mo -55.2–60.4

Vapour deficit909 Pa 648–1,324

Wind speed2.00 m/s 1.50–2.70

Cloud cover28.8 % 23.2–61.5

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)