Anilocra physodes

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Isopoda/Cymothoidae/Anilocra

At a glance

Occurrence records189

Data sources8

Biological traits2

DNA specimens8

eDNA detections16

Sources8 archives

Databases and archives Anilocra physodes's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility179 records↗

OBISOcean Biodiversity Information System10 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS189 records

Environmental DNA1 datasets · 1 countries16 detections

DNA & barcodingBOLD8 specimens

01Narrative

Anilocra physodes is een pissebed uit de familie Cymothoidae. De wetenschappelijke naam is gepubliceerd in 1758 door Linnaeus in de tiende editie van Systema naturae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonehost

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anilocra physodes has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes3

eDNA detections16

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P690 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Diversity (π)2.9%

Haplotypes2

BIN1

Most divergent pair4.8%

Where individuals differ — all 34 variable positions, in barcode order

2Avariable

3Gvariable

4Avariable

5Tmostly conserved

6Amostly conserved

8Tmostly conserved

10Gmostly conserved

12Amostly conserved

15Cmostly conserved

18Tmostly conserved

19Amostly conserved

23Tmostly conserved

24Amostly conserved

25Tmostly conserved

26Amostly conserved

29Tmostly conserved

33Gmostly conserved

34Cmostly conserved

36Tmostly conserved

37Gmostly conserved

38Amostly conserved

39Gmostly conserved

40Cmostly conserved

41Tmostly conserved

44Gmostly conserved

98Tmostly conserved

230Gmostly conserved

608Amostly conserved

677Tvariable

681Avariable

682Cvariable

683Cvariable

684Avariable

685Avariable

AAGATATTGGAACCCTTTATTTTATATTTGGGGCTTGAGCTGGGGTAGTGGGAGTGGCGTTTAGAATACTGATTCGGTCCGAACTATCTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anilocra capensissame genus14.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type189 records

Wild obs. + sensor143

Museum / vouchered30

Other16

Range

Area of Occupancy AOO464 km²

Depth

0–200 m sunlit1

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 20 m · max 20 m · 1 record with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 49≤1 km 28≤10 km 12

89 georeferenced · 54 without coordinates

Open the mapobservation + sensor143

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤1 km 4≤10 km 3>10 km 2

9 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence30

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museum für Naturkunde Berlin (Zoological Collections)location not on record	10
Frankfurt am Main	4
Brussels, BE	3
Helsinki, FI	2
Paris, FR	1
RBINS-Scientific Heritagelocation not on record	1
South Kensington, GB	1

7 institutions · 22 of 30 vouchered records shown

09Environmental DNA16 detections

Where the DNA of Anilocra physodes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map1 country0

Marine

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.7 °C 21.5–23.9

Seasonal swing summer↔winter12.5 °C

Max temp (day)25.4 °C 23.8–26.9

Min temp (night)19.8 °C 18.9–20.6

Precipitation2.10 mm/mo 1.50–2.70

Air humidity62.0 % 61.5–62.4

Vapour deficit1,052 Pa 963–1,141

Cloud cover15.6 % 11.9–19.3

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)