Anilocra capensis

Leach, 1818 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Isopoda/Cymothoidae/Anilocra

At a glance

Occurrence records61

Data sources9

Biological traits2

DNA specimens12

eDNA detections12

Sources9 archives

Databases and archives Anilocra capensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility49 records↗

OBISOcean Biodiversity Information System12 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS61 records

Environmental DNA1 datasets · 1 countries12 detections

DNA & barcodingBOLD12 specimens

01Narrative

Anilocra capensis is a species of parasitic isopod in the family Cymothoidae. It is endemic to southern Africa. The species preferentially attaches itself to the hottentot seabream.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonehost

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anilocra capensis has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections12

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P636 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Where individuals differ — all 99 variable positions, in barcode order

3Gmostly conserved

9Tmostly conserved

27Cmostly conserved

34Tmostly conserved

36Gmostly conserved

39Tmostly conserved

48Amostly conserved

55Cmostly conserved

57Tmostly conserved

58Gmostly conserved

60Gmostly conserved

66Tmostly conserved

72Amostly conserved

81Tmostly conserved

93Tmostly conserved

102Cmostly conserved

108Amostly conserved

117Tmostly conserved

120Gmostly conserved

138Cmostly conserved

145Tmostly conserved

159Tmostly conserved

162Tmostly conserved

180Avariable

200Gmostly conserved

201Amostly conserved

216Amostly conserved

222Amostly conserved

223Tmostly conserved

250Amostly conserved

267Cmostly conserved

276Tmostly conserved

279Amostly conserved

282Cmostly conserved

288Tmostly conserved

291Gmostly conserved

297Amostly conserved

300Tmostly conserved

306Gmostly conserved

307Tmostly conserved

309Gmostly conserved

315Gmostly conserved

318Gmostly conserved

319Gmostly conserved

321Gmostly conserved

324Tmostly conserved

330Gmostly conserved

333Tmostly conserved

341Tmostly conserved

348Cmostly conserved

351Tmostly conserved

354Cmostly conserved

357Cmostly conserved

363Tmostly conserved

372Gmostly conserved

375Amostly conserved

378Amostly conserved

387Tmostly conserved

388Cmostly conserved

390Tmostly conserved

399Tmostly conserved

408Tmostly conserved

411Cmostly conserved

414Cmostly conserved

420Tmostly conserved

426Amostly conserved

429Tmostly conserved

435Gmostly conserved

441Gmostly conserved

447Gmostly conserved

459Cmostly conserved

460Tmostly conserved

468Amostly conserved

471Gmostly conserved

489Gmostly conserved

495Gmostly conserved

498Gmostly conserved

504Tmostly conserved

507Amostly conserved

508Cmostly conserved

516Avariable

519Gmostly conserved

528Cmostly conserved

534Amostly conserved

537Amostly conserved

540Gmostly conserved

543Amostly conserved

546Cmostly conserved

549Cmostly conserved

555Tmostly conserved

567Tmostly conserved

573Tmostly conserved

579Gmostly conserved

582Tmostly conserved

585Amostly conserved

588Cmostly conserved

600Cmostly conserved

603Amostly conserved

609Amostly conserved

GGGGTGGCTTTTAGAATACTGATTCGCTCTGAATTGTCTCAACCAGGAAATCTACTTGGGAGAGATCAATTATACAATGCTATTGTCACA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.7%

Haplotypes3

BIN1

Most divergent pair0.63%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anilocra physodessame genus14.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type61 records

Wild obs. + sensor50

Museum / vouchered11

Range

Area of Occupancy AOO120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 21≤1 km 5

26 georeferenced · 24 without coordinates

Open the mapobservation + sensor50

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Johannesburglocation not on record	1
Museum für Naturkunde Berlin (Zoological Collections)location not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
UM-RSMASlocation not on record	1
South Kensington, GB	1
Frankfurt am Main	1
Brussels, BE	1

7 institutions · 7 of 11 vouchered records shown

09Environmental DNA12 detections

Where the DNA of Anilocra capensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.8 °C 25.8–25.8

Seasonal swing summer↔winter15.6 °C

Max temp (day)32.9 °C

Min temp (night)18.7 °C

Precipitation64.6 mm/mo

Air humidity48.0 %

Moisture balance-139 mm/mo

Vapour deficit1,734 Pa

Wind speed3.00 m/s

Cloud cover31.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)