Anigraea rubida

Walker, 1862 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Euteliidae/Anigraea

At a glance

Occurrence records51

Data sources6

Biological traits0

DNA specimens6

eDNA detections6

Sources6 archives

Databases and archives Anigraea rubida's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility51 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF51 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD6 specimens

01Narrative

Anigraea rubida is een vlinder uit de familie van de Euteliidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1862 door Walker.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anigraea rubida has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P662 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.3%

Haplotypes2

BIN1

Most divergent pair1.4%

Where individuals differ — all 18 variable positions, in barcode order

49Cvariable

67Amostly conserved

79Amostly conserved

133Cmostly conserved

197Cvariable

206Tmostly conserved

217Avariable

250Cvariable

337Tmostly conserved

346Tmostly conserved

364Tvariable

478Tmostly conserved

493Gmostly conserved

553Cmostly conserved

568Tmostly conserved

574Cmostly conserved

578Cmostly conserved

631Amostly conserved

AACATTATATTTTATTTTCGGAATTTGAGCAGGAATAGTAGGAACATCCTTAAGACTATTAATTCGAGCAGAATTAGGAAATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anigraea homochroasame genus6.1%Neumoegenia poeticasame order7.3%Bagisara oulasame order7.8%Dasyboarmia hyperdasyssame order7.8%Xanthodes embolosciasame order7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type51 records

Wild obs. + sensor5

Museum / vouchered46

Range

Area of Occupancy AOO48 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 4

4 georeferenced · 1 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 46 records without

Open the institutions mapphysical evidence46

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Taiwan Forestry Research Institutelocation not on record	21
FACTlocation not on record	19
Helsinki, FI	5

3 institutions · 45 of 46 vouchered records shown · 1 without an institution code

09Environmental DNA6 detections

Where the DNA of Anigraea rubida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.0 °C 20.6–24.1

Seasonal swing summer↔winter1.20 °C

Max temp (day)24.9 °C 24.7–26.9

Min temp (night)17.1 °C 16.6–20.5

Precipitation360 mm/mo 193–466

Air humidity67.3 % 66.5–68.5

Moisture balance237 mm/mo 50.8–329

Vapour deficit831 Pa 771–986

Wind speed1.60 m/s 1.30–1.70

Cloud cover45.3 % 27.7–62.8

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)