Anguilla obscura

Günther, 1872 · species

image placeholder — illustration coming later

Animalia/Chordata/Anguilliformes/Anguillidae/Anguilla

At a glance

Occurrence records367

Data sources12

Biological traits9

DNA specimens16

eDNA detections6

Sources12 archives

Databases and archives Anguilla obscura's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility173 records↗

OBISOcean Biodiversity Information System194 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources9 traits

Occurrence & distributionGBIF · OBIS367 records

Environmental DNA2 datasets · 4 countries6 detections

DNA & barcodingBOLD16 specimens

Genome at a glanceGoaT · NCBI≈882 Mbp

01Narrative

The Pacific shortfinned eel (Anguilla obscura), also known as the Pacific shortfinned freshwater eel, the short-finned eel, and the South Pacific eel,Common names for Anguilla obscura at www.fishbase.org. is an eel in the family Anguillidae.Anguilla obscura at www.fishbase.org. It was described by Albert Günther in 1871.Günther, A., 1871 (Apr.) [ref. 1997] Report on several collections of fishes recently obtained for the British Museum. Proceedings of the Zoological Society of London 1871 (pt 3): 652-675, Pls. 53-70. It is a tropical, freshwater eel which is known from western New Guinea, Queensland, Australia, the Society Islands, and possibly South Africa. The eels spend most of their lives in freshwater, but migrate to the Pacific Ocean to breed. Males can reach a maximum total length of 110 centimetres, but more commonly reach a TL of around 60 cm. The Pacific shortfinned eel is most similar to Anguilla australis (more commonly known as the Short-finned eel), and Anguilla bicolor (the Indonesian shortfin eel), but can be distinguished by the number of vertebrae. The Pacific shortfinned eel feeds primarily off of bony fish (including the genus Oreochromis),Food items reported for Anguilla obscura at www.fishbase.org. crustaceans and mollusks. It is a commercial eel in subsistence fisheries.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length110 cm

Habitat & environment4

Habitat brackishyes

Habitat freshwateryes

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importancesubsistence fisheries

Other traits3

Depth max3 000 m

Depth min0 m

Vulnerability66

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anguilla obscura has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes12

eDNA detections6

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P666 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.08%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

21Tmostly conserved

GGTACCCTATATCTAGTATTTGGTGCCTGAGCCGGAATAGTGGGAACCGCACTAAGCCTTCTAATCCGTGCCGAATTAAGTCAACCAGGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anguilla marmoratasame genus3.6%Anguilla bengalensissame genus4.6%Anguilla bicolorsame genus4.8%Anguilla nebulosasame genus5.0%Anguilla interiorissame genus5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND612S

animal barcodemitochondrialmarker

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_006545 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBs-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Anguilla obscura carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈882 390 062 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anguilla obscura0.88 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness78.7% BUSCO

07Deep time~4.53 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin4.53 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type367 records

Wild obs. + sensor99

Museum / vouchered225

Other43

Range

Area of Occupancy AOO532 km²

Depth

0–200 m sunlit55

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0 m · max 22 m · 55 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 30≤1 km 39≤10 km 13>10 km 8

90 georeferenced · 9 without coordinates

Open the mapobservation + sensor99

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 15≤1 km 49≤10 km 28>10 km 1

93 georeferenced · 132 without coordinates

Open the institutions mapphysical evidence225

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natick, US	38
Sydney, AU	22
Paris, FR	7
Washington, US	4
Toronto, CA	3
Copenhagen, DK	3
ARMS-MBONlocation not on record	2
Museum national d'Histoire naturellelocation not on record	2
FishBaselocation not on record	2
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	1
Western Australian Museumlocation not on record	1

11 institutions · 85 of 225 vouchered records shown · 1 without an institution code

09Environmental DNA6 detections

Where the DNA of Anguilla obscura was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys2

Countries4

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map4 countries0

Lotic water bodyIndustrial port; industrial; 9.4 - Subtidal …Marine Protected Area; protected; 9.2 - Subt…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.8 °C 9.30–22.2

Seasonal swing summer↔winter8.30 °C

Max temp (day)21.4 °C 11.6–23.2

Min temp (night)15.9 °C 6.50–21.2

Precipitation82.7 mm/mo 55.3–95.1

Air humidity61.3 % 59.8–63.0

Moisture balance-34.3 mm/mo

Vapour deficit809 Pa 479–1,056

Wind speed4.50 m/s

Cloud cover35.4 % 31.5–42.5

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)