Anguilla bengalensis

(Gray, 1831) · species

image placeholder — illustration coming later

Animalia/Chordata/Anguilliformes/Anguillidae/Anguilla

At a glance

Occurrence records687

Data sources9

Biological traits8

DNA specimens76

eDNA detections140

Sources9 archives

Databases and archives Anguilla bengalensis's data was compiled from.

WikipediaWikimedia Foundation12 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility359 records↗

OBISOcean Biodiversity Information System328 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI140 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics76 specimens↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources8 traits

Occurrence & distributionGBIF · OBIS687 records

Environmental DNA1 datasets · 6 countries140 detections

DNA & barcodingBOLD76 specimens

01Narrative

The mottled eel (Anguilla bengalensis), also known as the African mottled eel, the Indian longfin eel, the Indian mottled eel, the long-finned eel or the river eel,Common names for Anguilla nebulosa at www.fishbase.org. is a demersal, catadromoushttp://thewebsiteofeverything.com/animals/fish/Anguilliformes/Anguillidae/Anguilla-nebulosa eel in the family Anguillidae.Anguilla nebulosa at www.fishbase.org. It was described by John McClelland in 1844.McClelland, J., 1844 (5 July) [ref. 2928] Apodal fishes of Bengal. Calcutta Journal of Natural History v. 5 (no. 18): 151-226, Pls. 5-14. It is a tropical, freshwater eel which is known from East Africa, Bangladesh, Andaman Islands, Mozambique, Malawi, Sri Lanka, Sumatra, and Indonesia and recently from Madagascar. The eels spend most of their lives in freshwater at a depth range of 3–10 metres, but migrate to the Indian Ocean to breed. Males can reach a maximum total length of 121 centimetres and a maximum weight of 7,000 grams. The eels feed primarily off of benthic crustaceans, mollusks, finfish and worms.Food items reported for Anguilla nebulosa at www.fishbase.org. The exact classification of the species was a debate in recent times, where some major fish websites (ex. Fish Base) classified the species under the name A. nebulosa. But according to the IUCN Red List 2015 version, the fish species should be classified as A. bengalensis with some subspecies.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length200 cm

Body mass6 000 g

Habitat & environment4

Habitat brackishyes

Habitat freshwateryes

Habitat saltwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importancecommercial

Other traits1

Vulnerability90

05DNA & barcoding76 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anguilla bengalensis has left across the world's sequence archives.

At a glance

DNA specimens76

BINs2

Marker genes12

eDNA detections140

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus63 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

8Cmostly conserved

34Gmostly conserved

214Cmostly conserved

217Tmostly conserved

262Cmostly conserved

313Gmostly conserved

340Cvariable

427Gmostly conserved

604Cmostly conserved

622Amostly conserved

625Tmostly conserved

CCTATATCTAGTATTTGGTGCCTGAGCCGGAATGGTGGGAACCGCACTAAGCCTTCTAATCCGTGCTGAATTAAGTCAACCAGGCGCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.89%

Haplotypes10

BINs2

Most divergent pair7.4%

AsiaAfricaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anguilla marmoratasame genus3.3%Anguilla interiorissame genus4.4%Anguilla obscurasame genus4.6%Anguilla celebesensissame genus5.7%Anguilla bicolorsame genus6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16SCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcoderibosomalmitochondrial

07Deep time~7.71 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin7.71 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type687 records

Wild obs. + sensor37

Museum / vouchered37

Other613

Origin

Native3

Range

Area of Occupancy AOO280 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy6% within 1 km

≤1 km 1>10 km 17

18 georeferenced · 19 without coordinates

Open the mapobservation + sensor37

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3>10 km 2

5 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence37

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South African Institute for Aquatic Biodiversitylocation not on record	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Stockholm, SE	1
Natural History Museum, Tribhuvan Universitylocation not on record	1
Chicago, US	1
Sher-e-Bangla Agricultural University, Department of Fisheries Biology and Genetics, Aquatic Bioresource Research Lablocation not on record	1
Ann Arbor, US	1
Texas Cooperative Wildlife Collectionlocation not on record	1

8 institutions · 11 of 37 vouchered records shown · 11 without an institution code

09Environmental DNA140 detections

Where the DNA of Anguilla bengalensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found140

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 140 detections have coordinates

Open the map6 countries0

MangroveRiver

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.0 °C 25.2–27.6

Seasonal swing summer↔winter1.10 °C

Max temp (day)30.2 °C 28.0–31.0

Min temp (night)22.4 °C 20.2–23.7

Precipitation208 mm/mo 6.90–309

Air humidity67.7 % 51.5–68.8

Moisture balance80.3 mm/mo -107–162

Vapour deficit1,080 Pa 1,043–1,493

Wind speed1.40 m/s 0.7–3.40

Cloud cover48.7 % 27.1–66.0

CHELSA 1981–2010, ~9 km grid, at location & month of 68 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)