Anguilla mossambica

(Peters, 1852) · species

image placeholder — illustration coming later

Animalia/Chordata/Anguilliformes/Anguillidae/Anguilla

At a glance

Occurrence records2 024

Data sources11

Biological traits9

DNA specimens25

eDNA detections15

Sources11 archives

Databases and archives Anguilla mossambica's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 367 records↗

OBISOcean Biodiversity Information System657 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements2 literature sources9 traits

Occurrence & distributionGBIF · OBIS2 024 records

Environmental DNA1 datasets · 1 countries15 detections

DNA & barcodingBOLD25 specimens

01Narrative

The African longfin eelCommon names for Anguilla mossambica at www.fishbase.org. (Anguilla mossambica), also known simply as the longfin eel, is an eel in the family Anguillidae.Anguilla mossambica at www.fishbase.org. It was described by Wilhelm Peters in 1852, originally under the genus Muraena.Peters, W. (C. H.), 1852 [ref. 18539] Diagnosen von neuen Flussfischen aus Mossambique. Monatsberichte der Königlichen Preuss[ischen] Akademie der Wissenschaften zu Berlin 1852: 275-276, 681-685. It is a tropical eel known from freshwaters in southern Kenya, Cape Agulhas, Madagascar, and New Caledonia. The eels spend most of their lives in freshwaters far inland, but migrate to the Western Indian Ocean to breed. Males can reach a maximum total length of 150 centimetres; females can reach a maximum standard length of 120 centimetres and a maximum weight of 5,000 grams. The eels can live for about 20 years. Juveniles and adults are known to feed off of carcasses, crabs, and bony fish.Food items reported for Anguilla mossambica at www.fishbase.org.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAnAgeFishBase

Size & morphology2

Body length150 cm

Body mass412 g

⚠ sources differ — AnAge: 412 g · FishBase: 5 730 g

Life cycle & reproduction1

Max. longevity240 months

Habitat & environment4

Habitat brackishyes

Habitat freshwateryes

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importancecommercial

Other traits1

Vulnerability81.42

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anguilla mossambica has left across the world's sequence archives.

At a glance

DNA specimens25

BINs1

Marker genes11

eDNA detections15

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P613 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

87Tmostly conserved

135Gmostly conserved

207Cmostly conserved

366Amostly conserved

367Amostly conserved

453Gmostly conserved

576Gmostly conserved

608Cvariable

CTAAGCCTTCTGATCCGTGCCGAATTAAGTCAACCAGGCGCCCTTCTTGGAGATGATCAAATTTACAATGTCATCGTCACAGCGCATGCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.26%

Haplotypes4

BIN1

Most divergent pair0.65%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anguilla marmoratasame genus6.6%Anguilla obscurasame genus6.7%Anguilla celebesensissame genus7.2%Anguilla rostratasame genus7.3%Anguilla australissame genus7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_006542 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBs-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

07Deep time~16.9 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin16.9 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type2 024 records

Wild obs. + sensor297

Museum / vouchered1 242

Other485

Origin

Native586

Range

Area of Occupancy AOO2 840 km²

Depth

0–200 m sunlit45

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0.3 m · max 152.5 m · 45 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy16% within 1 km

≤100 m 27≤1 km 7≤10 km 123>10 km 57

214 georeferenced · 83 without coordinates

Open the mapobservation + sensor297

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 5≤1 km 2≤10 km 14>10 km 1

22 georeferenced · 1 220 without coordinates

Open the institutions mapphysical evidence1 242

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South African Institute for Aquatic Biodiversitylocation not on record	574
FishBaselocation not on record	23
Paris, FR	5
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	2
	2
Royal Museum for Central Africalocation not on record	1
Stockholm, SE	1
Cambridge, US	1
South Kensington, GB	1

9 institutions · 610 of 1 242 vouchered records shown · 19 without an institution code

09Environmental DNA15 detections

Where the DNA of Anguilla mossambica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.7 °C 19.5–24.6

Seasonal swing summer↔winter4.40 °C

Max temp (day)27.4 °C 24.2–28.3

Min temp (night)20.0 °C 14.3–22.0

Precipitation153 mm/mo 134–161

Air humidity62.5 % 59.5–63.7

Moisture balance-26.2 mm/mo -35.0–21.9

Vapour deficit1,048 Pa 906–1,148

Wind speed2.80 m/s 2.40–5.70

Cloud cover28.1 % 26.1–28.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anguilla mossambica

At a glance

Sources11 archives

Size & morphology2

Life cycle & reproduction1

Habitat & environment4

Uses & economy1

Other traits1

At a glance

At a glance

When this lineage existed

Record type2 024 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 024 records