Anemonia viridis

(Forsskål, 1775) · species

image placeholder — illustration coming later

Animalia/Cnidaria/Anthozoa/Actiniaria/Actiniidae/Anemonia

At a glance

Occurrence records32 401

Data sources13

Biological traits2

DNA specimens26

eDNA detections19

Sources13 archives

Databases and archives Anemonia viridis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility23 580 records↗

OBISOcean Biodiversity Information System8 821 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS32 401 records

Environmental DNA1 datasets · 2 countries19 detections

DNA & barcodingBOLD26 specimens

Genome at a glanceGoaT · NCBI≈401 Mbp

01Narrative

The snakelocks anemone (Anemonia viridis) is a sea anemone found in the eastern Atlantic Ocean and the Mediterranean Sea. The latter population is however sometimes considered a separate species, the Mediterranean snakelocks anemone (Anemonia sulcata). The tentacles are usually a deep green colour with purple tips, the green colour is often attributed to the presence of symbiotic algae within the tentacles but is actually the result of the presence of Green Fluorescent Protein which is present in corals, sea anemones, and some other cnidarians. The anemone tissue contains a symbiotic algae called zooxanthellae, which is necessary for the long-term survival of the sea anemone. When the numbers of algae diminish the anemone may appear dull grey in colour. The algae need light to flourish, so Snakelocks Anemones will be found in the sunniest pools. On average the snakelock anemone is 8 cm wide.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anemonia viridis has left across the world's sequence archives.

At a glance

DNA specimens26

BINs1

Marker genes4

eDNA detections19

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P624 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

TATTTAGTGTTTGGAATAGGATCCGGTATGATAGGCACAGCTTTAAGTATGTTAATAAGATTGGAGTTGTCTGCCCCTGGTACTATGTTA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Stichodactyla haddonisame order3.4%Anemonia alicemartinaesame genus3.5%Urticinopsis antarcticasame family3.8%Aulactinia marplatensissame family4.0%Bolocera tuediaesame family4.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS118S-5P18S-V4

animal barcodefungal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_037177 ↗ · 15 protein · 2 tRNA · 2 rRNA

ND5ND1ND3ND2coiihypothetical proteinND4ND6CYTBcoiiicoitruncated homing endonucleaseND4LATP8ATP6small subunit ribosomal RNAlarge subunit ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Anemonia viridis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈400 604 393 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anemonia viridis0.40 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness55.6% BUSCO

07Deep time~25 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin25 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard periods (Jurassic, Cretaceous…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. The dashed rules marked ✦ are the five great mass extinctions. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock originmass extinction

08Occurrence & distribution

Record type32 401 records

Wild obs. + sensor23 901

Museum / vouchered7 405

Other1 095

Origin

Native4

Range

Area of Occupancy AOO18 660 km²

Depth

0–200 m sunlit4 673

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 7.9 m · max 41 m · 4 673 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 13 659≤1 km 2 331≤10 km 594>10 km 133

16 717 georeferenced · 7 184 without coordinates

Open the mapobservation + sensor23 901

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 301

301 georeferenced · 7 104 without coordinates

Open the institutions mapphysical evidence7 405

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DASSHlocation not on record	150
PNHSlocation not on record	86
Institut Francais pour l'Etude de la Merlocation not on record	26
AUTHlocation not on record	24
486location not on record	17
South Kensington, GB	8
Natural History Museum, Londonlocation not on record	4
Station Biologique de Roscoff (EDMO:521)location not on record	3
Citadel Hill, GB	1
UCA - SOCIBlocation not on record	1

10 institutions · 320 of 7 405 vouchered records shown

09Environmental DNA19 detections

Where the DNA of Anemonia viridis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map2 countries0

MarineSubtidal seagrass bed (Z.marina)

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.6 °C 7.00–14.2

Seasonal swing summer↔winter11.3 °C

Max temp (day)12.8 °C 8.20–17.4

Min temp (night)7.80 °C 4.80–10.8

Precipitation173 mm/mo 141–204

Air humidity60.9 % 57.6–64.3

Moisture balance124 mm/mo 84.6–163

Vapour deficit536 Pa 372–700

Wind speed4.30 m/s 3.20–5.30

Cloud cover46.3 % 41.8–50.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anemonia viridis

At a glance

Sources13 archives

Habitat & environment2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

At a glance

When this lineage existed

Record type32 401 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type32 401 records