Andricus quercusradicis

(Fabricius, 1798) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Cynipidae/Andricus

At a glance

Occurrence records375

Data sources6

Biological traits0

DNA specimens19

eDNA detections88

Sources6 archives

Databases and archives Andricus quercusradicis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility375 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI88 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF375 records

Environmental DNA3 datasets · 6 countries88 detections

DNA & barcodingBOLD19 specimens

01Narrative

De truffelgalwesp is een vliesvleugelig insect uit de familie van de echte galwespen (Cynipidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1798 door Fabricius.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andricus quercusradicis has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes1

eDNA detections88

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

2Amostly conserved

6Tmostly conserved

7Amostly conserved

9Amostly conserved

11Tmostly conserved

13Tmostly conserved

14Amostly conserved

16Amostly conserved

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

20Gmostly conserved

21Gmostly conserved

22Amostly conserved

23Amostly conserved

24Tmostly conserved

25Tmostly conserved

27Gmostly conserved

28Amostly conserved

29Tmostly conserved

30Cmostly conserved

31Tmostly conserved

32Gmostly conserved

33Gmostly conserved

49Avariable

88Avariable

AATATTATATTTTATATTTGGAATTTGATCTGGAATAATTGGATCAGGATTAAGAATAATTATTCGTATAGAATTAGGAATACCTTTACA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes4

BIN1

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andricus sieboldisame genus5.3%Andricus foecundatrixsame genus5.6%Andricus curvatorsame genus5.8%Andricus kollarisame genus6.3%Trigonaspis megapterasame family6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type375 records

Wild obs. + sensor152

Museum / vouchered223

Range

Area of Occupancy AOO636 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy26% within 1 km

≤100 m 25≤1 km 12≤10 km 103>10 km 3

143 georeferenced · 9 without coordinates

Open the mapobservation + sensor152

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 96≤1 km 4≤10 km 2>10 km 6

108 georeferenced · 115 without coordinates

Open the institutions mapphysical evidence223

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Nacional de Ciencias Naturales (CSIC)location not on record	109
Trondheim, NO	94
Zürich, CH	9
Gothenburg, SE	5
Helsinki, FI	1
Nijmegen, NL	1
neflocation not on record	1
Tilburg, NL	1
SLU Artdatabankenlocation not on record	1
MZLUlocation not on record	1

10 institutions · 223 of 223 vouchered records shown

09Environmental DNA88 detections

Where the DNA of Andricus quercusradicis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found88

Studies independent surveys3

Countries6

Verifiable raw sequence linked65

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 88 detections have coordinates

Open the map6 countries0

1. Forest & Woodland | 1.4. Temperate Forest1.1. Boreal Forest|1. Forest & Woodland14. Artificial - Terrestrial | 14.5 Urban Ar…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 6.00–17.2

Seasonal swing summer↔winter17.5 °C

Max temp (day)19.5 °C 10.1–20.9

Min temp (night)11.8 °C 2.20–13.8

Precipitation67.4 mm/mo 45.5–103

Air humidity60.8 % 57.1–63.0

Moisture balance-30.8 mm/mo -64.7–8.40

Vapour deficit683 Pa 371–772

Wind speed3.30 m/s 2.50–4.20

Cloud cover44.6 % 40.3–54.3

CHELSA 1981–2010, ~9 km grid, at location & month of 87 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)