Andricus foecundatrix

(Hartig, 1840) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Cynipidae/Andricus

At a glance

Occurrence records18 173

Data sources7

Biological traits0

DNA specimens10

eDNA detections1

Sources7 archives

Databases and archives Andricus foecundatrix's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility18 173 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF18 173 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD10 specimens

01Narrative

Andricus foecundatrix (formerly Andricus fecundator) is a parthenogenetic gall wasp which lays a single egg within a leaf bud, using its ovipositor, to produce a gall known as an oak artichoke gall, oak hop gall, larch-cone gall or hop strobileA Nature Observer's Scrapbook The gall develops as a chemically induced distortion of leaf axillary or terminal buds on pedunculate oak (Quercus robur) or sessile oak (Quercus petraea) trees. The larva lives inside a smaller hard casing inside the artichoke and this is released in autumn. The asexual wasp emerges in spring and lays her eggs in the oak catkins. These develop into small oval galls which produce the sexual generation of wasps.Galls on UK SafariThe Virtual Filed Guide UK A yew artichoke gall caused by the fly Taxomyia taxi also exists, but is unrelated to the oak-borne species. Previous names or synonyms for the species A. fecundator are A. fecundatrix, A. pilosus, A. foecundatrix (see below), A. gemmarum, A. gemmae, A. gemmaequercus, A. gemmaecinaraeformis and A. quercusgemmae. The scientific name is now once again Andricus foecundatrix.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andricus foecundatrix has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

20Amostly conserved

59Tmostly conserved

89Gmostly conserved

116Cmostly conserved

140Tmostly conserved

218Tmostly conserved

269Tvariable

296Gvariable

338Tvariable

341Tvariable

431Amostly conserved

446Tmostly conserved

530Tmostly conserved

614Cvariable

632Cmostly conserved

644Tvariable

TATTATATTTTATATTTGGAATTTGGTCAGGAATAATTGGTTCAGGATTAAGAATAATTATTCGAATAGAATTAGGAATACCTTTACAGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.94%

Haplotypes7

BIN1

Most divergent pair1.8%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andricus quercusramulisame genus4.9%Andricus callidomasame genus4.9%Andricus amentisame genus4.9%Andricus curvatorsame genus5.0%Andricus quercusradicissame genus5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

07Deep time~0 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin0 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type18 173 records

Wild obs. + sensor18 134

Museum / vouchered39

Origin

Native1

Range

Area of Occupancy AOO24 496 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy30% within 1 km

≤100 m 3 596≤1 km 1 100≤10 km 10 848>10 km 109

15 653 georeferenced · 2 481 without coordinates

Open the mapobservation + sensor18 134

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 2≤1 km 8>10 km 1

11 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence39

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Nacional de Ciencias Naturales (CSIC)location not on record	25
Tilburg, NL	2
Trondheim, NO	1
Provincia di Livornolocation not on record	1
Naturalis Biodiversity Centerlocation not on record	1
Nijmegen, NL	1
Helsinki, FI	1
neflocation not on record	1

8 institutions · 33 of 39 vouchered records shown · 6 without an institution code

09Environmental DNA1 detections

Where the DNA of Andricus foecundatrix was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.9 °C 17.9–17.9

Seasonal swing summer↔winter14.8 °C

Max temp (day)21.8 °C

Min temp (night)14.0 °C

Precipitation75.8 mm/mo

Air humidity60.9 %

Moisture balance-21.6 mm/mo

Vapour deficit801 Pa

Wind speed2.70 m/s

Cloud cover38.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andricus foecundatrix

At a glance

Sources7 archives

At a glance

At a glance

When this lineage existed

Record type18 173 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type18 173 records