Andrena synadelpha

Perkins, 1914 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records575

Data sources6

Biological traits0

DNA specimens18

eDNA detections16

Sources6 archives

Databases and archives Andrena synadelpha's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility575 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF575 records

Environmental DNA2 datasets · 6 countries16 detections

DNA & barcodingBOLD18 specimens

01Narrative

De breedrandzandbij is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1914 door Perkins.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena synadelpha has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes1

eDNA detections16

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

31Amostly conserved

500Tmostly conserved

628Cmostly conserved

631Tmostly conserved

TATACTATACTTTATTTTCGCAATATGAGCAGGTATAATCGGAGCATCCCTGAGATTTATTATCCGTATAGAATTAAGAAATCCAGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.17%

Haplotypes4

BIN1

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena fulvasame genus3.2%Andrena clarkellasame genus7.5%Andrena praecoxsame genus7.8%Andrena helvolasame genus8.2%Andrena mitissame genus8.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type575 records

Wild obs. + sensor369

Museum / vouchered199

Other7

Origin

Native18

Range

Area of Occupancy AOO1 412 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy56% within 1 km

≤100 m 150≤1 km 50≤10 km 154>10 km 1

355 georeferenced · 14 without coordinates

Open the mapobservation + sensor369

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 4≤1 km 18≤10 km 105>10 km 2

129 georeferenced · 70 without coordinates

Open the institutions mapphysical evidence199

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Muzeum Górnośląskie w Bytomiulocation not on record	51
ULglocation not on record	39
Wuzhou, CN	15
Natural History Museum Rotterdamlocation not on record	14
CBDClocation not on record	6
Bavarian State Collection of Zoologylocation not on record	6
South Kensington, GB	6
Provincia di Livornolocation not on record	5
ZSMlocation not on record	4
PRUNlocation not on record	4
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	4
Paro, BT	3
PRAZlocation not on record	2
Nijmegen, NL	2
SGAV-and-NHMDlocation not on record	2
Tilburg, NL	2
Geneva, CH	1
NMOKlocation not on record	1
Mons, BE	1
Bonn, DE	1
Adam Mickiewicz University in Poznańlocation not on record	1

21 institutions · 170 of 199 vouchered records shown · 29 without an institution code

09Environmental DNA16 detections

Where the DNA of Andrena synadelpha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys2

Countries6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.9 °C 10.0–14.5

Seasonal swing summer↔winter16.7 °C

Max temp (day)17.1 °C 14.0–18.0

Min temp (night)8.10 °C 4.80–10.1

Precipitation60.0 mm/mo 51.8–109

Air humidity59.6 % 58.8–61.7

Moisture balance-48.2 mm/mo -55.8–-10.1

Vapour deficit602 Pa 477–663

Wind speed3.70 m/s 2.90–4.30

Cloud cover38.3 % 30.8–44.9

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)