Andrena suerinensis

Friese, 1884 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records247

Data sources8

Biological traits0

DNA specimens10

eDNA detections4

Sources8 archives

Databases and archives Andrena suerinensis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility247 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF247 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD10 specimens

01Narrative

Andrena suerinensis is a species of insect belonging to the family Andrenidae. It is native to Central Europe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena suerinensis has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections4

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

294Amostly conserved

558Tmostly conserved

CTATACTTTATTTTCGCTATATGAGCAGGCATAGTTGGAGCCTCACTCAGATTTATTATTCGAATAGAATTAAGAAACCCAGGAAGATGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.15%

Haplotypes3

BIN1

Most divergent pair0.31%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena japonicasame genus11.1%Andrena agilissimasame genus11.4%Andrena scitasame genus11.7%Andrena pilipessame genus11.7%Andrena tibialissame genus11.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type247 records

Wild obs. + sensor39

Museum / vouchered155

Other53

Origin

Native54

Range

Area of Occupancy AOO380 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy56% within 1 km

≤100 m 6≤1 km 14≤10 km 14>10 km 2

36 georeferenced · 3 without coordinates

Open the mapobservation + sensor39

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 1≤1 km 57≤10 km 63>10 km 5

126 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence155

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Coimbra, PT	43
NMOKlocation not on record	34
Provincia di Livornolocation not on record	16
Wuzhou, CN	7
ZSMlocation not on record	6
Zürich, CH	6
Bavarian State Collection of Zoologylocation not on record	6
Muzeum Górnośląskie w Bytomiulocation not on record	4
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	4
KZMlocation not on record	3
PRUNlocation not on record	2
PRAZlocation not on record	2
Paro, BT	2
Musee d'Histoire Naturallelocation not on record	2
	2
UGRlocation not on record	1
Uniwersytet Łódzkilocation not on record	1

17 institutions · 141 of 155 vouchered records shown · 14 without an institution code

09Environmental DNA4 detections

Where the DNA of Andrena suerinensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 13.4–17.4

Seasonal swing summer↔winter18.4 °C

Max temp (day)20.0 °C 17.5–21.6

Min temp (night)10.7 °C 8.30–12.2

Precipitation60.8 mm/mo 59.4–66.7

Air humidity58.2 % 57.9–58.5

Moisture balance-59.3 mm/mo -66.2–-38.5

Vapour deficit761 Pa 646–839

Wind speed3.10 m/s 2.70–3.20

Cloud cover35.8 % 34.8–36.8

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)