Andrena pilipes

Fabricius, 1781 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records2 318

Data sources7

Biological traits0

DNA specimens56

eDNA detections93

Sources7 archives

Databases and archives Andrena pilipes's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 318 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI93 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics56 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 318 records

Environmental DNA1 datasets · 17 countries93 detections

DNA & barcodingBOLD56 specimens

01Narrative

Andrena pilipes is a Palearctic species of mining bee.BWARSEdward Saunders 1896, The Hymenoptera Aculeata of the British Isles London. pdf us.archive Full text with illustrations]

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding56 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena pilipes has left across the world's sequence archives.

At a glance

DNA specimens56

BINs1

Marker genes1

eDNA detections93

Countries17

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus48 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

19Tvariable

22Cmostly conserved

286Cmostly conserved

400Gvariable

445Tmostly conserved

499Cmostly conserved

539Cmostly conserved

565Amostly conserved

595Tmostly conserved

AATATTATATTTTCTATTTGCCATATGAGCAGGTATAGTTGGAGCCTCTCTCAGATTCATTATTCGTATAGAACTAAGTAACCCAGGAGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.51%

Haplotypes9

BIN1

Most divergent pair1.7%

EuropeAfricaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena tibialissame genus4.9%Andrena bimaculatasame genus6.0%Andrena japonicasame genus6.7%Andrena agilissimasame genus9.3%Andrena scitasame genus10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 318 records

Wild obs. + sensor1 248

Museum / vouchered821

Cultivated / captive1

Other248

Origin

Native125

Range

Area of Occupancy AOO4 492 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 506≤1 km 325≤10 km 295>10 km 9

1 135 georeferenced · 113 without coordinates

Open the mapobservation + sensor1 248

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 22≤1 km 210≤10 km 362>10 km 39

633 georeferenced · 188 without coordinates

Open the institutions mapphysical evidence821

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	156
Zürich, CH	122
KZMlocation not on record	96
Wuzhou, CN	50
Bern, CH	28
Natural History Museum Rotterdamlocation not on record	27
ZSMlocation not on record	26
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	22
Coimbra, PT	21
Provincia di Livornolocation not on record	18
Sion, CH	16
NMOKlocation not on record	14
Cambridge, US	13
UMONSlocation not on record	9
Adam Mickiewicz University in Poznańlocation not on record	8
Paro, BT	8
NCMGlocation not on record	8
IENElocation not on record	6
Museum zu Allerheiligen Schaffhausenlocation not on record	6
Musee d'Histoire Naturallelocation not on record	6
Museu Nacional de História Natural e da Ciêncialocation not on record	6
CBDClocation not on record	5
	5
Bavarian State Collection of Zoologylocation not on record	5
Philadelphia, US	4
PRUNlocation not on record	4
PRAZlocation not on record	4
Champaign, US	3
Winterthur, CH	2
Uniwersytet Łódzkilocation not on record	2
Frauenfeld, CH	2
Nijmegen, NL	1
UGRlocation not on record	1
Institute of Biodiversity and Ecosystem Research, Bulgarian Academy of Scienceslocation not on record	1
Research Collection of Christophe Prazlocation not on record	1
Ugentlocation not on record	1
Muzeum Górnośląskie w Bytomiulocation not on record	1
Geneva, CH	1

38 institutions · 709 of 821 vouchered records shown · 112 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA93 detections

Where the DNA of Andrena pilipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found93

Studies independent surveys1

Countries17

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 93 detections have coordinates

Open the map17 countries0

Herbaceous dune vegetationMediterranean maquiscoastal dunes

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 8.30–19.5

Seasonal swing summer↔winter18.7 °C

Max temp (day)19.9 °C 11.9–23.7

Min temp (night)11.5 °C 4.60–14.8

Precipitation54.5 mm/mo 37.1–93.1

Air humidity59.0 % 54.6–63.4

Moisture balance-54.5 mm/mo -110–-5.90

Vapour deficit745 Pa 471–996

Wind speed3.40 m/s 2.40–4.40

Cloud cover39.7 % 30.7–45.5

CHELSA 1981–2010, ~9 km grid, at location & month of 89 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena pilipes

At a glance

Sources7 archives

At a glance

Record type2 318 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 38 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 318 records