Andrena simontornyella

Noskiewicz, 1939 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records455

Data sources6

Biological traits2

DNA specimens41

eDNA detections35

Sources6 archives

Databases and archives Andrena simontornyella's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility455 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI35 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics41 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF455 records

Environmental DNA1 datasets · 4 countries35 detections

DNA & barcodingBOLD41 specimens

01Narrative

Andrena simontornyella is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1939 door Noskiewicz.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology2

Intertegular distance (ITD)1.31 mm

Tongue length1.35 mm

05DNA & barcoding41 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena simontornyella has left across the world's sequence archives.

At a glance

DNA specimens41

BINs2

Marker genes2

eDNA detections35

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

71Cmostly conserved

85Gmostly conserved

163Gmostly conserved

232Tmostly conserved

307Cmostly conserved

319Amostly conserved

439Cmostly conserved

514Avariable

ATTATATTTCATTTTCGCCATATGATCCGGAATAATTGGAGCCTCATTAAGATTTATTATTCGAATAGAACTAAGAAATCCAGGGAATTG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.52%

Haplotypes10

BINs2

Most divergent pair4.0%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena rugothoracesame genus9.2%Andrena enslinellasame genus9.3%Andrena falsificasame genus10.0%Andrena semirugosasame genus10.1%Andrena nanulasame genus10.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

08Occurrence & distribution

Record type455 records

Wild obs. + sensor166

Museum / vouchered239

Other50

Origin

Native46

Range

Area of Occupancy AOO900 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy39% within 1 km

≤100 m 13≤1 km 13≤10 km 36>10 km 5

67 georeferenced · 99 without coordinates

Open the mapobservation + sensor166

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 8≤1 km 78≤10 km 116

202 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence239

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	86
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	14
PRAZlocation not on record	10
Zürich, CH	8
Bern, CH	6
ENSAT - L'Ecole Nationale Superieure Agronomique de Toulouselocation not on record	4
Champaign, US	4
	3
Musee d'Histoire Naturallelocation not on record	2
PRUNlocation not on record	2
ZSMlocation not on record	2
Wuzhou, CN	2
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
WIlocation not on record	1
Philadelphia, US	1
UMUlocation not on record	1

16 institutions · 148 of 239 vouchered records shown · 91 without an institution code

09Environmental DNA35 detections

Where the DNA of Andrena simontornyella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found35

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 35 detections have coordinates

Open the map4 countries0

Rivuline vegetationGarden

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.2 °C 5.60–14.4

Seasonal swing summer↔winter15.5 °C

Max temp (day)14.4 °C 8.60–18.6

Min temp (night)5.40 °C 2.60–9.40

Precipitation83.8 mm/mo 54.2–93.5

Air humidity60.0 % 56.7–66.4

Moisture balance-7.40 mm/mo -42.2–60.0

Vapour deficit505 Pa 307–697

Wind speed4.00 m/s 3.00–4.50

Cloud cover42.4 % 39.2–51.4

CHELSA 1981–2010, ~9 km grid, at location & month of 34 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)