Andrena pusilla

Pérez, 1903 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records303

Data sources5

Biological traits1

DNA specimens69

eDNA detections71

Sources5 archives

Databases and archives Andrena pusilla's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility303 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI71 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics69 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF303 records

Environmental DNA1 datasets · 6 countries71 detections

DNA & barcodingBOLD69 specimens

01Narrative

De breedbanddwergzandbij is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1903 door Pérez.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)1.25 mm

05DNA & barcoding69 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena pusilla has left across the world's sequence archives.

At a glance

DNA specimens69

BINs2

Marker genes1

eDNA detections71

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus63 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.36%

Haplotypes2

BINs2

Most divergent pair0.15%

ATTATATTTCATTTTCGCTATATGATCCGGAATAATTGGGGCCTCACTAAGATTCATCATCCGAATAGAGTTAAGAAATCCAGGAAACTG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena spretasame genus4.6%Andrena lunarissame genus9.5%Andrena enslinellasame genus10.6%Andrena semilaevissame genus10.7%Andrena simontornyellasame genus11.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type303 records

Wild obs. + sensor92

Museum / vouchered196

Other15

Origin

Native10

Range

Area of Occupancy AOO484 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy39% within 1 km

≤100 m 4≤1 km 12≤10 km 20>10 km 5

41 georeferenced · 51 without coordinates

Open the mapobservation + sensor92

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤1 km 59≤10 km 73>10 km 1

133 georeferenced · 63 without coordinates

Open the institutions mapphysical evidence196

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NMOKlocation not on record	36
Provincia di Livornolocation not on record	35
Zürich, CH	32
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	12
ZSMlocation not on record	4
Bavarian State Collection of Zoologylocation not on record	4
Geneva, CH	3
Bern, CH	2
PRUNlocation not on record	2
Natural History Museum Rotterdamlocation not on record	2
MNHWlocation not on record	1
Philadelphia, US	1
Wuzhou, CN	1
Muzeum Górnośląskie w Bytomiulocation not on record	1
Bonn, DE	1
	1
Natuurpuntlocation not on record	1
Research Collection of Christophe Prazlocation not on record	1
Research Collection of David Genoudlocation not on record	1

19 institutions · 141 of 196 vouchered records shown · 55 without an institution code

09Environmental DNA71 detections

Where the DNA of Andrena pusilla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found71

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 71 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.6 °C 10.1–17.6

Seasonal swing summer↔winter15.8 °C

Max temp (day)21.6 °C 13.2–21.6

Min temp (night)12.6 °C 5.50–12.6

Precipitation52.6 mm/mo 52.5–73.8

Air humidity59.0 % 58.0–60.1

Moisture balance-73.9 mm/mo -73.9–8.50

Vapour deficit826 Pa 515–826

Wind speed2.90 m/s 2.60–3.40

Cloud cover38.0 % 37.6–44.7

CHELSA 1981–2010, ~9 km grid, at location & month of 69 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)