Andrena persimulata

Viereck, 1917 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records291

Data sources7

Biological traits1

DNA specimens15

eDNA detections20

Sources7 archives

Databases and archives Andrena persimulata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility291 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF291 records

Environmental DNA1 datasets · 1 countries20 detections

DNA & barcodingBOLD15 specimens

01Narrative

The protuberance miner bee (Andrena persimulata) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.31 mm

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena persimulata has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections20

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

34Amostly conserved

343Amostly conserved

370Amostly conserved

538Amostly conserved

544Cmostly conserved

655Amostly conserved

656Tmostly conserved

AATGTTATATTTTATATTCGCTATATGAGCAGGAATAATCGGTGCTTCTTTAAGATTTATCATCCGAATAGAGCTAAGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.22%

Haplotypes4

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena platypariasame genus5.9%Andrena fragilissame genus7.4%Andrena ventralissame genus10.1%Andrena sericatasame genus10.3%Andrena parvicepssame genus10.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type291 records

Wild obs. + sensor2

Museum / vouchered289

Range

Area of Occupancy AOO448 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤1 km 26≤10 km 42>10 km 5

73 georeferenced · 216 without coordinates

Open the institutions mapphysical evidence289

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cornell University Insect Collectionlocation not on record	114
WIlocation not on record	77
Champaign, US	34
Beltsville, US	7
Toronto, CA	6
	6
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	4
St. Paul, US	4
US	3
Toronto, CA	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
OSUClocation not on record	2
Saint John, CA	2
University of Western Ontariolocation not on record	2
White River Junction, US	2
UNHClocation not on record	2
Zadock Thompson Natural History Collection, University of Vermontlocation not on record	2
Washington, US	1
WSUClocation not on record	1

19 institutions · 274 of 289 vouchered records shown · 15 without an institution code

09Environmental DNA20 detections

Where the DNA of Andrena persimulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map1 country0

BeachAgricultural field

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 8.40–16.4

Seasonal swing summer↔winter30.0 °C

Max temp (day)18.9 °C 12.6–22.4

Min temp (night)8.80 °C 3.50–12.5

Precipitation80.7 mm/mo 64.7–86.0

Air humidity56.1 % 54.1–58.7

Moisture balance-49.7 mm/mo -68.7–-0.8

Vapour deficit691 Pa 541–814

Wind speed3.40 m/s 2.00–4.10

Cloud cover44.0 % 41.0–55.1

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)