Andrena nana

(Kirby, 1802) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records1 096

Data sources6

Biological traits1

DNA specimens27

eDNA detections24

Sources6 archives

Databases and archives Andrena nana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 096 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF1 096 records

Environmental DNA1 datasets · 6 countries24 detections

DNA & barcodingBOLD27 specimens

01Narrative

Andrena nana is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1802 door Kirby.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)1.58 mm

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena nana has left across the world's sequence archives.

At a glance

DNA specimens27

BINs2

Marker genes1

eDNA detections24

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Diversity (π)1.4%

Haplotypes2

BINs2

Most divergent pair0.15%

Where individuals differ — all 59 variable positions, in barcode order

1Tmostly conserved

2Amostly conserved

3Tmostly conserved

4Gmostly conserved

5Cmostly conserved

6Tmostly conserved

7Amostly conserved

8Tmostly conserved

9Amostly conserved

22Tmostly conserved

34Amostly conserved

46Cmostly conserved

48Cmostly conserved

50Cmostly conserved

74Tmostly conserved

88Amostly conserved

90Gmostly conserved

91Amostly conserved

121Cmostly conserved

139Tmostly conserved

145Tmostly conserved

157Cmostly conserved

235Tmostly conserved

265Amostly conserved

272Cmostly conserved

310Cmostly conserved

322Amostly conserved

340Tmostly conserved

343Tmostly conserved

364Tmostly conserved

374Tmostly conserved

376Cmostly conserved

391Amostly conserved

394Tmostly conserved

397Cmostly conserved

416Amostly conserved

457Tmostly conserved

460Gmostly conserved

499Tmostly conserved

505Tmostly conserved

528Cmostly conserved

532Tmostly conserved

539Cmostly conserved

544Cmostly conserved

557Cmostly conserved

559Cmostly conserved

601Cmostly conserved

613Tmostly conserved

616Cmostly conserved

631Amostly conserved

643Gmostly conserved

646Tmostly conserved

649Amostly conserved

650Cmostly conserved

651Amostly conserved

652Tmostly conserved

654Tmostly conserved

655Amostly conserved

657Tmostly conserved

TATGCTATATTTTATTTTCGCTATATGATCAGGAATAATTGGAGCCTCACTAAGATTTATTATTCGAATAGAATTAAGAAATCCAGGAAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena lunarissame genus9.4%Andrena subopacasame genus9.7%Andrena komachisame genus10.5%Andrena rugulosasame genus10.5%Andrena maguntasame genus10.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 096 records

Wild obs. + sensor213

Museum / vouchered775

Other108

Origin

Native229

Range

Area of Occupancy AOO1 628 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy27% within 1 km

≤100 m 5≤1 km 33≤10 km 101>10 km 3

142 georeferenced · 71 without coordinates

Open the mapobservation + sensor213

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 24≤1 km 227≤10 km 453>10 km 3

707 georeferenced · 68 without coordinates

Open the institutions mapphysical evidence775

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	188
Zürich, CH	91
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	75
Geneva, CH	38
Musee d'Histoire Naturallelocation not on record	26
Bern, CH	24
MZLUlocation not on record	18
USALlocation not on record	17
Coimbra, PT	16
NCMGlocation not on record	16
Bonn, DE	15
ZSMlocation not on record	14
NMOKlocation not on record	14
Bavarian State Collection of Zoologylocation not on record	12
Paro, BT	10
Sion, CH	8
	8
Wuzhou, CN	7
PRUNlocation not on record	5
Champaign, US	5
Cambridge, US	5
Gothenburg, SE	4
Dhaka, BD	4
Philadelphia, US	2
University of Florence, Department of Biologylocation not on record	1
ULglocation not on record	1
Tromsø, NO	1
UGRlocation not on record	1
KZMlocation not on record	1
Muzeum Górnośląskie w Bytomiulocation not on record	1

30 institutions · 628 of 775 vouchered records shown · 147 without an institution code

09Environmental DNA24 detections

Where the DNA of Andrena nana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.60 °C 5.70–20.3

Seasonal swing summer↔winter15.4 °C

Max temp (day)11.6 °C 8.80–25.4

Min temp (night)3.10 °C 2.70–14.2

Precipitation85.0 mm/mo 30.2–107

Air humidity61.3 % 53.9–66.2

Moisture balance27.5 mm/mo -133–51.8

Vapour deficit420 Pa 310–1,077

Wind speed4.50 m/s 2.60–4.50

Cloud cover46.1 % 32.9–51.0

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena nana

At a glance

Sources6 archives

Size & morphology1

At a glance

Record type1 096 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 096 records