Andrena marginata

Fabricius, 1776 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records4 718

Data sources9

Biological traits1

DNA specimens25

eDNA detections19

Sources9 archives

Databases and archives Andrena marginata's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 718 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF4 718 records

Environmental DNA1 datasets · 9 countries19 detections

DNA & barcodingBOLD25 specimens

Genome at a glanceGoaT · NCBI≈374 Mbp

01Narrative

Andrena marginata, sometimes called the small scabious mining bee is a species of the sand bee (Andrena) genus.Bisby F.A., Roskov Y.R., Orrell T.M., Nicolson D., Paglinawan L.E., Bailly N., Kirk P.M., Bourgoin T., Baillargeon G., Ouvrard D. (red.) (2011). "Species 2000 & ITIS Catalogue of Life: 2011 Annual Checklist"

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)1.95 mm

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena marginata has left across the world's sequence archives.

At a glance

DNA specimens25

BINs1

Marker genes1

eDNA detections19

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

4Avariable

5Cmostly conserved

21Cmostly conserved

35Amostly conserved

40Tmostly conserved

74Tmostly conserved

82Tmostly conserved

115Cmostly conserved

151Cmostly conserved

271Cmostly conserved

310Tmostly conserved

322Tmostly conserved

340Cvariable

463Tmostly conserved

502Gmostly conserved

516Tmostly conserved

AATACTATATTTCATTTTCGCTATATGAGCAGGAATAATTGGAGCATCACTCAGATTTATTATCCGTATAGAATTAAGAAATCCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.53%

Haplotypes4

BIN1

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena pellucenssame genus9.3%Andrena birtwellisame genus10.0%Andrena albopunctatasame genus10.1%Andrena florivagasame genus10.9%Andrena rufitibialissame genus10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Andrena marginata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈373 639 974 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Andrena marginata0.37 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness96.8% BUSCO

08Occurrence & distribution

Record type4 718 records

Wild obs. + sensor3 441

Museum / vouchered1 229

Other48

Origin

Native149

Range

Area of Occupancy AOO5 272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 2 648≤1 km 465≤10 km 251>10 km 12

3 376 georeferenced · 65 without coordinates

Open the mapobservation + sensor3 441

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 66≤1 km 355≤10 km 599>10 km 12

1 032 georeferenced · 197 without coordinates

Open the institutions mapphysical evidence1 229

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 45 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	188
Helsinki, FI	180
Provincia di Livornolocation not on record	174
Zürich, CH	97
Wuzhou, CN	82
MZLUlocation not on record	68
Bonn, DE	40
ULglocation not on record	35
Dhaka, BD	24
NMOKlocation not on record	17
Gothenburg, SE	17
Philadelphia, US	13
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	13
Trondheim, NO	12
Bern, CH	12
Musee d'Histoire Naturallelocation not on record	11
Muzeum Górnośląskie w Bytomiulocation not on record	10
ZSMlocation not on record	10
Sion, CH	8
Bavarian State Collection of Zoologylocation not on record	8
Cambridge, US	7
NCMGlocation not on record	7
BioFokuslocation not on record	7
Geneva, CH	7
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	5
KZMlocation not on record	4
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	4
Frauenfeld, CH	4
Natural History Museum Rotterdamlocation not on record	4
	4
Universität Zürich, Naturhistorisches Museumlocation not on record	4
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	4
neflocation not on record	4
ZMAAlocation not on record	4
Paro, BT	2
NHMOlocation not on record	2
CBDClocation not on record	2
MNHWlocation not on record	1
Ghent, BE	1
Tallinn, EE	1
Tromsø, NO	1
Stockholm, SE	1
South Kensington, GB	1
Mons, BE	1
Champaign, US	1

45 institutions · 1 102 of 1 229 vouchered records shown · 127 without an institution code

09Environmental DNA19 detections

Where the DNA of Andrena marginata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map9 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 12.7–19.1

Seasonal swing summer↔winter18.0 °C

Max temp (day)19.2 °C 17.5–23.5

Min temp (night)13.2 °C 6.90–15.3

Precipitation67.5 mm/mo 55.5–104

Air humidity60.3 % 56.6–63.3

Moisture balance-43.7 mm/mo -74.2–17.8

Vapour deficit742 Pa 580–964

Wind speed3.20 m/s 1.80–4.00

Cloud cover41.3 % 33.9–48.1

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena marginata

At a glance

Sources9 archives

Size & morphology1

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type4 718 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions22 of 45 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 718 records