Andrena lupinorum

Cockerell, 1906 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records2 972

Data sources7

Biological traits0

DNA specimens19

eDNA detections4

Sources7 archives

Databases and archives Andrena lupinorum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 972 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 972 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD19 specimens

01Narrative

The lupine miner bee (Andrena chlorogaster) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena lupinorum has left across the world's sequence archives.

At a glance

DNA specimens19

BINs2

Marker genes1

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

49Cmostly conserved

79Tmostly conserved

82Cmostly conserved

100Tmostly conserved

115Tmostly conserved

124Tmostly conserved

139Tmostly conserved

157Tmostly conserved

172Cmostly conserved

205Gmostly conserved

229Gmostly conserved

232Gmostly conserved

235Tmostly conserved

263Cmostly conserved

277Amostly conserved

343Amostly conserved

370Amostly conserved

382Amostly conserved

385Cmostly conserved

410Gmostly conserved

421Amostly conserved

427Cmostly conserved

544Tmostly conserved

634Tmostly conserved

AATATTATATTTTATTTTTGCTATATGAGCAGGAATAATTGGAGCTTCCCTAAGATTTATTATTCGAATAGAACTAAGTAACCCAGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.70%

Haplotypes3

BINs2

Most divergent pair3.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena commodasame genus3.6%Andrena assimilissame genus7.0%Andrena vicinasame genus7.4%Andrena nivalissame genus7.9%Andrena montrosensissame genus10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 972 records

Wild obs. + sensor19

Museum / vouchered2 953

Range

Area of Occupancy AOO1 204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 8≤1 km 1≤10 km 2>10 km 3

14 georeferenced · 5 without coordinates

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 10≤1 km 58≤10 km 20>10 km 8

96 georeferenced · 2 857 without coordinates

Open the institutions mapphysical evidence2 953

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	2 320
WIlocation not on record	375
Wuzhou, CN	62
	49
Royal Saskatchewan Museumlocation not on record	43
Weber State University, Bird and Mammal Collectionlocation not on record	26
St. Paul, US	17
Colorado State Universitylocation not on record	16
Champaign, US	16
US	12
Philadelphia, US	5
Cambridge, US	2
Vancouver, CA	2
Royal British Columbia Museumlocation not on record	2
Natural History Museum of Utahlocation not on record	1
Canadian Museum of Naturelocation not on record	1
Lexington, US	1
Universidad Católica de Manizaleslocation not on record	1
WSUClocation not on record	1

19 institutions · 2 952 of 2 953 vouchered records shown · 1 without an institution code

09Environmental DNA4 detections

Where the DNA of Andrena lupinorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

UngrazedStabilizing dune

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 3.60–14.8

Seasonal swing summer↔winter25.0 °C

Max temp (day)15.5 °C 8.50–21.1

Min temp (night)3.50 °C -2.40–9.30

Precipitation49.0 mm/mo 28.3–69.5

Air humidity52.8 % 45.5–54.1

Moisture balance-68.0 mm/mo -73.3–-33.3

Vapour deficit708 Pa 380–935

Wind speed2.80 m/s 2.40–4.00

Cloud cover40.8 % 36.4–43.1

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena lupinorum

At a glance

Sources7 archives

At a glance

Record type2 972 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 972 records