Andrena commoda

Smith, 1879 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records1 945

Data sources7

Biological traits3

DNA specimens36

eDNA detections50

Sources7 archives

Databases and archives Andrena commoda's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 945 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI50 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF1 945 records

Environmental DNA1 datasets · 2 countries50 detections

DNA & barcodingBOLD36 specimens

01Narrative

The advantaged miner bee (Andrena commoda) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology3

Body length1.11 cm

Intertegular distance (ITD)3.05 mm

Wing length9.4 mm

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena commoda has left across the world's sequence archives.

At a glance

DNA specimens36

BINs1

Marker genes1

eDNA detections50

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus36 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

556Gmostly conserved

AATATTATATTTTATTTTTGCTATATGAGCAGGAATAATTGGAGCCTCTCTAAGATTTATTATCCGAATAGAACTAAGAAATCCAGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.05%

Haplotypes3

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena lupinorumsame genus3.6%Andrena assimilissame genus6.8%Andrena nivalissame genus7.1%Andrena vicinasame genus7.1%Andrena wataseisame genus9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 945 records

Wild obs. + sensor6

Museum / vouchered1 939

Range

Area of Occupancy AOO1 760 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 3≤1 km 2>10 km 1

6 georeferenced

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 15≤1 km 104≤10 km 311>10 km 16

446 georeferenced · 1 493 without coordinates

Open the institutions mapphysical evidence1 939

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
US	367
Champaign, US	347
University Park, US	299
St. Paul, US	110
	93
Wuzhou, CN	91
FWSlocation not on record	85
OSUClocation not on record	82
Cornell University Insect Collectionlocation not on record	68
WIlocation not on record	68
Beltsville, US	56
UNHClocation not on record	25
Universidad Católica de Manizaleslocation not on record	22
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	18
Cambridge, US	18
Colorado State Universitylocation not on record	16
Toronto, CA	15
New Haven, US	15
Zadock Thompson Natural History Collection, University of Vermontlocation not on record	14
Toronto, CA	11
Chicago, US	10
University of Guelph, Centre for Biodiversity Genomicslocation not on record	9
White River Junction, US	9
WSUClocation not on record	7
University of Western Ontariolocation not on record	5
Weber State University, Bird and Mammal Collectionlocation not on record	4
Royal Saskatchewan Museumlocation not on record	3
Philadelphia, US	2
New Haven, US	2
LULlocation not on record	2
Blacksburg, US	1
Lexington, US	1
University of Nebraska State Museumlocation not on record	1

33 institutions · 1 876 of 1 939 vouchered records shown · 63 without an institution code

09Environmental DNA50 detections

Where the DNA of Andrena commoda was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found50

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 50 detections have coordinates

Open the map2 countries0

GrasslandwoodlandUrban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.1 °C 12.1–18.1

Seasonal swing summer↔winter25.4 °C

Max temp (day)16.5 °C 16.5–23.6

Min temp (night)8.50 °C 8.20–13.4

Precipitation86.7 mm/mo 75.4–86.7

Air humidity55.7 % 55.0–56.7

Moisture balance-27.6 mm/mo -66.8–-27.6

Vapour deficit624 Pa 624–899

Wind speed2.80 m/s 2.20–3.80

Cloud cover44.7 % 41.1–45.5

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena commoda

At a glance

Sources7 archives

Size & morphology3

At a glance

Record type1 945 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 33 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 945 records