Andrena hypopolia

Schmiedeknecht, 1884 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records298

Data sources6

Biological traits0

DNA specimens13

eDNA detections13

Sources6 archives

Databases and archives Andrena hypopolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility298 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF298 records

Environmental DNA1 datasets · 3 countries13 detections

DNA & barcodingBOLD13 specimens

01Narrative

Andrena hypopolia is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1884 door Schmiedeknecht.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena hypopolia has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections13

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.14%

Haplotypes1

BIN1

Where individuals differ — all 2 variable positions, in barcode order

50Cmostly conserved

316Avariable

TATGCTATACTTCATTTTCGCTATATGAGCAGGTATAATTGGAGCCTCCCTAAGATTCATTATTCGCATAGAATTAAGCAATCCAGGGAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena numidasame genus5.5%Andrena ranunculorumsame genus7.0%Andrena parathoracicasame genus10.0%Andrena limatasame genus10.3%Andrena nitidasame genus10.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type298 records

Wild obs. + sensor17

Museum / vouchered194

Other87

Origin

Native41

Range

Area of Occupancy AOO428 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤1 km 12≤10 km 3>10 km 1

16 georeferenced · 1 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤1 km 37≤10 km 135>10 km 1

173 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence194

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	32
Wuzhou, CN	31
Geneva, CH	26
Bern, CH	21
Coimbra, PT	15
Sion, CH	13
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	11
NMOKlocation not on record	11
Zürich, CH	10
ZSMlocation not on record	6
Bavarian State Collection of Zoologylocation not on record	5
Universität Zürich, Naturhistorisches Museumlocation not on record	2
Private Collection of Thomas J. Woodlocation not on record	1
	1

14 institutions · 185 of 194 vouchered records shown · 9 without an institution code

09Environmental DNA13 detections

Where the DNA of Andrena hypopolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.0 °C 15.1–22.4

Seasonal swing summer↔winter18.3 °C

Max temp (day)23.4 °C 17.0–28.4

Min temp (night)14.4 °C 12.9–14.7

Precipitation67.7 mm/mo 30.7–101

Air humidity57.6 % 49.2–62.9

Moisture balance-65.1 mm/mo

Vapour deficit938 Pa 634–1,380

Wind speed3.60 m/s

Cloud cover33.9 % 31.0–39.6

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)