Andrena hirticincta

Provancher, 1888 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records3 451

Data sources7

Biological traits1

DNA specimens16

eDNA detections26

Sources7 archives

Databases and archives Andrena hirticincta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 451 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF3 451 records

Environmental DNA1 datasets · 2 countries26 detections

DNA & barcodingBOLD16 specimens

01Narrative

The hairy-belted miner bee (Andrena hirticincta) is a species of miner bee in the family Andrenidae. Another common name for this species is the hairy-banded andrena. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.55 mm

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena hirticincta has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections26

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

166Gmostly conserved

268Amostly conserved

343Cvariable

AATACTATACTTTATATTCGCAATATGAGCAGGCATAATTGGAGCATCACTAAGATTTATTATTCGAATAGAACTAAGAAATCCAGGTAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.16%

Haplotypes4

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena columbianasame genus6.4%Andrena costillensissame genus7.4%Andrena peckhamisame genus7.8%Andrena canadensissame genus8.5%Andrena nubeculasame genus8.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 451 records

Wild obs. + sensor1 483

Museum / vouchered1 968

Range

Area of Occupancy AOO5 644 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 875≤1 km 221≤10 km 53>10 km 150

1 299 georeferenced · 184 without coordinates

Open the mapobservation + sensor1 483

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 6≤1 km 94≤10 km 619>10 km 39

758 georeferenced · 1 210 without coordinates

Open the institutions mapphysical evidence1 968

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	499
	388
Cornell University Insect Collectionlocation not on record	261
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	120
WIlocation not on record	86
Champaign, US	75
New Haven, US	68
Toronto, CA	63
St. Paul, US	41
Beltsville, US	36
US	36
White River Junction, US	33
UNHClocation not on record	24
New Haven, US	24
Zadock Thompson Natural History Collection, University of Vermontlocation not on record	21
University Park, US	19
University of Guelphlocation not on record	11
Cleveland Museum of Natural History, OH (CLEV)location not on record	11
Lexington, US	9
FWSlocation not on record	8
OSUClocation not on record	7
Royal Saskatchewan Museumlocation not on record	6
Chicago, US	6
University of Central Floridalocation not on record	5
Wuzhou, CN	5
Saint John, CA	4
Middlebury Collegelocation not on record	4
Philadelphia, US	4
Colorado State Universitylocation not on record	2
LULlocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Vermont Center for Ecostudieslocation not on record	1
Blacksburg, US	1
Centre for Biodiversity Genomicslocation not on record	1
WSUClocation not on record	1
Decorah, US	1
University of Alabamalocation not on record	1
Toronto, CA	1

38 institutions · 1 887 of 1 968 vouchered records shown · 81 without an institution code

09Environmental DNA26 detections

Where the DNA of Andrena hirticincta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found26

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 26 detections have coordinates

Open the map2 countries0

14. Artificial - Terrestrial|14.5 Urban AreasRiparian ZoneTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.5 °C 10.5–19.5

Seasonal swing summer↔winter26.4 °C

Max temp (day)20.8 °C 16.6–24.5

Min temp (night)12.7 °C 4.00–15.8

Precipitation78.0 mm/mo 23.5–112

Air humidity59.3 % 46.0–61.6

Moisture balance-44.2 mm/mo -65.7–4.40

Vapour deficit822 Pa 646–929

Wind speed2.90 m/s 2.30–4.70

Cloud cover42.8 % 31.2–50.2

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena hirticincta

At a glance

Sources7 archives

Size & morphology1

At a glance

Record type3 451 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions19 of 38 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 451 records