Andrena canadensis

Dalla Torre, 1896 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records692

Data sources7

Biological traits0

DNA specimens10

eDNA detections1

Sources7 archives

Databases and archives Andrena canadensis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility692 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF692 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD10 specimens

01Narrative

The Canada miner bee (Andrena canadensis) is a species of miner bee in the family Andrenidae. Another common name for this species is the Canada andrena. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena canadensis has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.20%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 4 variable positions, in barcode order

292Tmostly conserved

293Amostly conserved

427Cvariable

565Tmostly conserved

AATATTATACTTTATATTTGCAATATGAGCAGGTATAATTGGAGCGTCCCTAAGATTTATTATTCGAATAGAATTAAGAAATCCAGGAAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena columbianasame genus7.6%Andrena freygessnerisame genus7.9%Andrena costillensissame genus7.9%Andrena peckhamisame genus8.4%Andrena scutellinitenssame genus8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type692 records

Wild obs. + sensor21

Museum / vouchered671

Range

Area of Occupancy AOO896 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 8≤1 km 2≤10 km 2>10 km 3

15 georeferenced · 6 without coordinates

Open the mapobservation + sensor21

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤100 m 3≤1 km 36≤10 km 283>10 km 18

340 georeferenced · 331 without coordinates

Open the institutions mapphysical evidence671

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	166
Champaign, US	94
	90
Cornell University Insect Collectionlocation not on record	73
WIlocation not on record	70
Toronto, CA	30
East Lansing, US	20
White River Junction, US	16
UNHClocation not on record	11
Lexington, US	9
US	7
Beltsville, US	6
Zadock Thompson Natural History Collection, University of Vermontlocation not on record	5
New Haven, US	4
OSUClocation not on record	4
Wuzhou, CN	3
Colorado State Universitylocation not on record	2
New Haven, US	2
St. Paul, US	1
York University, Packer Collectionlocation not on record	1
Chicago, US	1
Middlebury Collegelocation not on record	1
Albany, US	1
Royal Saskatchewan Museumlocation not on record	1

24 institutions · 618 of 671 vouchered records shown · 53 without an institution code

09Environmental DNA1 detections

Where the DNA of Andrena canadensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.0 °C 15.0–15.0

Seasonal swing summer↔winter24.9 °C

Max temp (day)19.0 °C

Min temp (night)12.4 °C

Precipitation105 mm/mo

Air humidity62.1 %

Moisture balance29.1 mm/mo

Vapour deficit643 Pa

Wind speed2.20 m/s

Cloud cover49.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)