Andrena frigida

Smith, 1853 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records1 942

Data sources7

Biological traits1

DNA specimens23

eDNA detections2

Sources7 archives

Databases and archives Andrena frigida's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 942 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF1 942 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD23 specimens

01Narrative

The cold miner bee (Andrena frigida) is a species of miner bee in the family Andrenidae. Another common name for this species is the frigid miner. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)3.01 mm

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena frigida has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes1

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)1.2%

Haplotypes2

BIN1

Most divergent pair1.8%

Where individuals differ — all 26 variable positions, in barcode order

2Tmostly conserved

16Tmostly conserved

37Tmostly conserved

47Cmostly conserved

64Tvariable

79Tmostly conserved

133Cmostly conserved

151Cmostly conserved

169Tmostly conserved

232Cvariable

310Amostly conserved

313Gmostly conserved

328Amostly conserved

340Amostly conserved

385Amostly conserved

439Tmostly conserved

454Tmostly conserved

497Cmostly conserved

526Tmostly conserved

553Gvariable

554Cvariable

577Cmostly conserved

607Cvariable

610Tmostly conserved

613Cmostly conserved

616Amostly conserved

ATTATATTTTATTTTTGCAATATGAGCAGGCATAATTGGAGCATCTCTAAGATTTATTATCCGTATAGAATTAAGAAATCCAGGAAATTG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena perarmatasame genus1.7%Andrena vicinoidessame genus6.8%Andrena milwaukeensissame genus7.0%Andrena clarkellasame genus7.5%Andrena fucatasame genus7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 942 records

Wild obs. + sensor550

Museum / vouchered1 392

Range

Area of Occupancy AOO2 788 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 286≤1 km 130≤10 km 18>10 km 33

467 georeferenced · 83 without coordinates

Open the mapobservation + sensor550

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 58≤1 km 221≤10 km 292>10 km 22

593 georeferenced · 799 without coordinates

Open the institutions mapphysical evidence1 392

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	179
	163
Beltsville, US	143
Champaign, US	99
Cambridge, US	93
Wuzhou, CN	88
WIlocation not on record	86
WSUClocation not on record	81
Vancouver, CA	72
Cornell University Insect Collectionlocation not on record	59
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	56
White River Junction, US	44
US	30
University Park, US	24
New Haven, US	23
UNHClocation not on record	17
Zadock Thompson Natural History Collection, University of Vermontlocation not on record	15
Weber State University, Bird and Mammal Collectionlocation not on record	13
New Haven, US	11
Santa Cruz, US	8
USU/EMUS/AEIlocation not on record	3
University of Alaska Museumlocation not on record	3
Colorado State Universitylocation not on record	3
Saint John, CA	2
OSUClocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Anchorage, US	2
University of Central Floridalocation not on record	2
Toronto, CA	1
Toronto, CA	1
Chicago, US	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1
VTFPRlocation not on record	1
UTSClocation not on record	1
University of Alabamalocation not on record	1
Universidad Católica de Manizaleslocation not on record	1

36 institutions · 1 331 of 1 392 vouchered records shown · 61 without an institution code

09Environmental DNA2 detections

Where the DNA of Andrena frigida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

woodlandwillow silt bar, Salix interior

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.3 °C 14.0–16.6

Seasonal swing summer↔winter34.2 °C

Max temp (day)20.3 °C 19.2–21.3

Min temp (night)9.80 °C 8.20–11.3

Precipitation77.9 mm/mo 68.9–86.9

Air humidity53.4 % 51.8–54.9

Moisture balance-46.1 mm/mo -53.7–-38.5

Vapour deficit821 Pa 725–916

Wind speed3.10 m/s 2.40–3.80

Cloud cover52.4 % 49.1–55.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena frigida

At a glance

Sources7 archives

Size & morphology1

At a glance

Record type1 942 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions18 of 36 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 942 records