Andrena colletiformis

Morawitz, 1874 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records209

Data sources6

Biological traits0

DNA specimens9

eDNA detections8

Sources6 archives

Databases and archives Andrena colletiformis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility209 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF209 records

Environmental DNA1 datasets · 5 countries8 detections

DNA & barcodingBOLD9 specimens

01Narrative

Andrena colletiformis is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1874 door Morawitz.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena colletiformis has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections8

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

394Tmostly conserved

421Gvariable

502Amostly conserved

523Cmostly conserved

595Cmostly conserved

596Cmostly conserved

601Tmostly conserved

613Cmostly conserved

631Tmostly conserved

AATACTATACTTCATTTTTGCCATATGAGCAGGTATAATTGGAGCATCACTAAGATTCATCATCCGAATAGAATTAAGAAATCCAGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.55%

Haplotypes4

BIN1

Most divergent pair1.2%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena miegiellasame genus10.0%Andrena fuscosasame genus10.5%Andrena florivagasame genus11.2%Andrena birtwellisame genus11.7%Andrena testaceipessame genus11.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type209 records

Wild obs. + sensor61

Museum / vouchered107

Other41

Origin

Native23

Range

Area of Occupancy AOO344 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 49≤10 km 8

57 georeferenced · 4 without coordinates

Open the mapobservation + sensor61

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 1≤1 km 19≤10 km 32>10 km 1

53 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence107

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	23
Coimbra, PT	23
Helsinki, FI	15
Wuzhou, CN	14
Zürich, CH	13
Muzeum Górnośląskie w Bytomiulocation not on record	2
Cambridge, US	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1
Institute of Biodiversity and Ecosystem Research, Bulgarian Academy of Scienceslocation not on record	1

9 institutions · 93 of 107 vouchered records shown · 14 without an institution code

09Environmental DNA8 detections

Where the DNA of Andrena colletiformis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map5 countries0

field margin

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.6 °C 17.6–24.8

Seasonal swing summer↔winter17.5 °C

Max temp (day)25.5 °C 19.2–30.0

Min temp (night)15.7 °C 12.9–18.1

Precipitation29.2 mm/mo 8.10–44.4

Air humidity54.9 % 49.8–60.6

Moisture balance-116 mm/mo -179–-111

Vapour deficit1,094 Pa 806–1,510

Wind speed2.80 m/s 2.20–3.20

Cloud cover35.8 % 22.8–39.7

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)