Andrena candida

Smith, 1879 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records2 398

Data sources7

Biological traits1

DNA specimens38

eDNA detections65

Sources7 archives

Databases and archives Andrena candida's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 398 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI65 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF2 398 records

Environmental DNA1 datasets · 2 countries65 detections

DNA & barcodingBOLD38 specimens

01Narrative

The mock-orange miner bee (Andrena candida) is a species of miner bee in the family Andrenidae. It is found in Central America and North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)1.65 mm

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena candida has left across the world's sequence archives.

At a glance

DNA specimens38

BINs1

Marker genes1

eDNA detections65

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus38 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

85Tvariable

343Cvariable

421Cvariable

AATATTATACTTTATCTTCGCTATATGAGCAGGAATAATCGGAGCTTCACTAAGATTTATTATTCGTATAGAATTAAGTAATCCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.31%

Haplotypes7

BIN1

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena w-scriptasame genus8.5%Andrena scurrasame genus9.9%Andrena knuthianasame genus10.3%Andrena mackieaesame genus10.6%Andrena viereckisame genus10.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 398 records

Wild obs. + sensor3

Museum / vouchered2 219

Other176

Range

Area of Occupancy AOO1 680 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 1

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 67≤1 km 293≤10 km 312>10 km 9

681 georeferenced · 1 538 without coordinates

Open the institutions mapphysical evidence2 219

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	738
Universidad Católica de Manizaleslocation not on record	271
Wuzhou, CN	245
Champaign, US	231
	220
Weber State University, Bird and Mammal Collectionlocation not on record	109
University of California, Davislocation not on record	84
San Diego, US	79
WSUClocation not on record	61
US	35
Mexico City, MX	31
OSUClocation not on record	26
Essig Museum of Entomologylocation not on record	16
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	12
Colorado State Universitylocation not on record	12
Natural History Museum of Utahlocation not on record	9
Cambridge, US	7
La Jolla, US	6
Vancouver, CA	4
BBSLlocation not on record	4
Oregon State Arthropod Collectionlocation not on record	2
US	2
WIlocation not on record	2
Toronto, CA	1
Santa Barbara Museum of Natural Historylocation not on record	1

25 institutions · 2 208 of 2 219 vouchered records shown · 11 without an institution code

09Environmental DNA65 detections

Where the DNA of Andrena candida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found65

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 65 detections have coordinates

Open the map2 countries0

commercial cranberry field1. Forest & Woodland8. Desert | 8.1. Hot Desert

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 8.00–17.7

Seasonal swing summer↔winter20.8 °C

Max temp (day)20.6 °C 13.9–24.8

Min temp (night)8.10 °C 1.40–12.1

Precipitation27.9 mm/mo 11.4–85.9

Air humidity53.0 % 40.9–59.5

Moisture balance-91.9 mm/mo -158–-26.7

Vapour deficit715 Pa 502–1,072

Wind speed2.80 m/s 1.80–4.70

Cloud cover38.0 % 25.1–46.1

CHELSA 1981–2010, ~9 km grid, at location & month of 62 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena candida

At a glance

Sources7 archives

Size & morphology1

At a glance

Record type2 398 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 398 records