Andrena buckelli

Viereck, 1924 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records154

Data sources7

Biological traits0

DNA specimens7

eDNA detections1

Sources7 archives

Databases and archives Andrena buckelli's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility154 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF154 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD7 specimens

01Narrative

The Buckell's miner bee (Andrena buckelli) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena buckelli has left across the world's sequence archives.

At a glance

DNA specimens7

BINs2

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

7Tvariable

118Cmostly conserved

205Amostly conserved

367Cmostly conserved

386Tmostly conserved

484Tmostly conserved

544Tmostly conserved

580Amostly conserved

610Tmostly conserved

619Tmostly conserved

628Tmostly conserved

646Tmostly conserved

649Gmostly conserved

AATTCTTTATTTCATTTTCGCAATATGGGCAGGTATAATTGGAGCCTCCTTAAGATTCATCATCCGTATAGAATTAAGAAATCCAGGGAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes3

BINs2

Most divergent pair2.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena thaspiisame genus4.3%Andrena vicinoidessame genus5.5%Andrena prolixasame genus5.7%Andrena rufosignatasame genus6.5%Andrena birtwellisame genus6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type154 records

Museum / vouchered122

Other32

Range

Area of Occupancy AOO332 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 6≤1 km 2≤10 km 29

37 georeferenced · 85 without coordinates

Open the institutions mapphysical evidence122

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	34
Champaign, US	23
Weber State University, Bird and Mammal Collectionlocation not on record	21
Wuzhou, CN	19
	15
WSUClocation not on record	7
Vancouver, CA	2
Colorado State Universitylocation not on record	1

8 institutions · 122 of 122 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Andrena buckelli was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)