Andrena bicolorata

(Rossi, 1790) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records139

Data sources6

Biological traits0

DNA specimens13

eDNA detections2

Sources6 archives

Databases and archives Andrena bicolorata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility139 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF139 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD13 specimens

01Narrative

Andrena bicolorata is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1790 door Rossi.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena bicolorata has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes2

eDNA detections2

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P640 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

15Cmostly conserved

55Amostly conserved

57Cmostly conserved

58Amostly conserved

59Tmostly conserved

60Cmostly conserved

62Gmostly conserved

63Tmostly conserved

70Tmostly conserved

195Tvariable

393Tmostly conserved

429Tmostly conserved

550Gmostly conserved

TTATATTTTATTTTCGCTATATGAGCTGGTATAATTGGAGCCTCACTAAGATTTATCATCCGTATAGAATTAAGAAATCCAGGAAGCTGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.50%

Haplotypes3

BIN1

Most divergent pair0.31%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena florentinasame genus6.1%Andrena limatasame genus10.3%Andrena thoracicasame genus10.3%Andrena medeninensissame genus10.5%Andrena assimilissame genus10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

08Occurrence & distribution

Record type139 records

Wild obs. + sensor79

Museum / vouchered36

Other24

Origin

Native1

Range

Area of Occupancy AOO300 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 24≤1 km 9≤10 km 14

47 georeferenced · 32 without coordinates

Open the mapobservation + sensor79

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤100 m 1≤1 km 1≤10 km 14>10 km 7

23 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence36

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	11
IMEDEAlocation not on record	5
	4
ENSAT - L'Ecole Nationale Superieure Agronomique de Toulouselocation not on record	2
Wuzhou, CN	1
Coimbra, PT	1

6 institutions · 24 of 36 vouchered records shown · 12 without an institution code

09Environmental DNA2 detections

Where the DNA of Andrena bicolorata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.9 °C 11.9–11.9

Seasonal swing summer↔winter15.8 °C

Max temp (day)16.1 °C

Min temp (night)6.80 °C

Precipitation80.3 mm/mo 75.4–85.2

Air humidity59.3 % 59.3–59.4

Moisture balance-19.2 mm/mo -25.0–-13.4

Vapour deficit566 Pa 566–566

Wind speed3.90 m/s 3.70–4.10

Cloud cover42.2 % 42.1–42.4

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)