Andrena aeneiventris

Morawitz, 1872 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records328

Data sources6

Biological traits2

DNA specimens15

eDNA detections15

Sources6 archives

Databases and archives Andrena aeneiventris's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility328 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF328 records

Environmental DNA1 datasets · 7 countries15 detections

DNA & barcodingBOLD15 specimens

01Narrative

Andrena aeneiventris is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1872 door Morawitz.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology2

Body length0.65 cm

Intertegular distance (ITD)0.86 mm

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena aeneiventris has left across the world's sequence archives.

At a glance

DNA specimens15

BINs3

Marker genes1

eDNA detections15

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 81% of positions are identical in every specimen.

Where individuals differ — all 126 variable positions, in barcode order

5Tmostly conserved

10Tmostly conserved

13Tmostly conserved

19Cmostly conserved

22Amostly conserved

31Amostly conserved

43Amostly conserved

49Amostly conserved

50Cmostly conserved

67Tmostly conserved

70Gmostly conserved

73Amostly conserved

79Tmostly conserved

82Tmostly conserved

89Amostly conserved

90Gmostly conserved

115Cmostly conserved

118Cmostly conserved

121Cmostly conserved

124Cmostly conserved

127Tmostly conserved

130Cmostly conserved

136Cmostly conserved

142Cmostly conserved

143Amostly conserved

151Tmostly conserved

157Cmostly conserved

166Gmostly conserved

178Cmostly conserved

181Amostly conserved

184Tmostly conserved

190Amostly conserved

199Cmostly conserved

205Gmostly conserved

206Tmostly conserved

212Tmostly conserved

214Amostly conserved

217Amostly conserved

220Gmostly conserved

223Cmostly conserved

226Cmostly conserved

229Gmostly conserved

232Tmostly conserved

235Cmostly conserved

247Cmostly conserved

250Cmostly conserved

259Tmostly conserved

268Amostly conserved

271Cmostly conserved

277Cmostly conserved

283Amostly conserved

284Amostly conserved

285Cmostly conserved

286Tmostly conserved

293Cmostly conserved

300Cmostly conserved

305Amostly conserved

307Amostly conserved

319Cmostly conserved

325Cmostly conserved

328Amostly conserved

331Amostly conserved

337Amostly conserved

340Cmostly conserved

343Amostly conserved

346Tmostly conserved

347Tmostly conserved

352Amostly conserved

357Tmostly conserved

358Tvariable

359Gmostly conserved

363Amostly conserved

367Cmostly conserved

370Amostly conserved

373Amostly conserved

376Gmostly conserved

379Cmostly conserved

385Cmostly conserved

403Cmostly conserved

406Tmostly conserved

408Tmostly conserved

409Tmostly conserved

412Tmostly conserved

415Amostly conserved

416Gmostly conserved

418Gmostly conserved

421Avariable

427Tmostly conserved

433Avariable

436Amostly conserved

439Tmostly conserved

442Cmostly conserved

445Tmostly conserved

458Cmostly conserved

463Tmostly conserved

475Amostly conserved

487Tmostly conserved

490Tmostly conserved

505Cmostly conserved

514Tmostly conserved

529Tmostly conserved

548Tmostly conserved

550Amostly conserved

553Cmostly conserved

556Gmostly conserved

557Tmostly conserved

562Amostly conserved

565Amostly conserved

568Tmostly conserved

571Tmostly conserved

592Amostly conserved

595Cmostly conserved

607Amostly conserved

619Amostly conserved

622Amostly conserved

625Amostly conserved

628Amostly conserved

634Cmostly conserved

640Tmostly conserved

641Cmostly conserved

+6 more variable positions not shown

TATATTATATTTTATATTCGCAATATGAGCAGGTATAATTGGAGCATCACTAAGATTCATTATTCGTATGGAATTAAGTAATCCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.0%

Haplotypes6

BINs3

Most divergent pair16.3%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena hedikaesame genus5.6%Andrena mocsaryisame genus11.2%Andrena florivagasame genus11.6%Andrena paucisquamasame genus11.6%Andrena pyrozonatasame genus12.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type328 records

Wild obs. + sensor46

Museum / vouchered258

Other24

Origin

Native79

Range

Area of Occupancy AOO472 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy8% within 1 km

≤100 m 1≤1 km 1≤10 km 24

26 georeferenced · 20 without coordinates

Open the mapobservation + sensor46

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤100 m 4≤1 km 21≤10 km 198>10 km 2

225 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence258

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Geneva, CH	37
Zürich, CH	33
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	22
	15
Bern, CH	14
Philadelphia, US	13
PRUNlocation not on record	12
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	12
Wuzhou, CN	9
Paro, BT	8
Sion, CH	8
Musee d'Histoire Naturallelocation not on record	8
Cambridge, US	6
Provincia di Livornolocation not on record	6
Coimbra, PT	3
Museum zu Allerheiligen Schaffhausenlocation not on record	2
University of Florence, Department of Biologylocation not on record	1
Beltsville, US	1
Muzeum Górnośląskie w Bytomiulocation not on record	1
NMOKlocation not on record	1
Institute of Biodiversity and Ecosystem Research, Bulgarian Academy of Scienceslocation not on record	1

21 institutions · 213 of 258 vouchered records shown · 45 without an institution code

09Environmental DNA15 detections

Where the DNA of Andrena aeneiventris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map7 countries0

sandy hill

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.0 °C 5.70–20.6

Seasonal swing summer↔winter14.7 °C

Max temp (day)15.4 °C 8.70–25.2

Min temp (night)4.20 °C 2.70–15.3

Precipitation83.8 mm/mo 36.6–90.1

Air humidity62.6 % 55.9–66.2

Moisture balance51.8 mm/mo -116–59.4

Vapour deficit501 Pa 310–1,070

Wind speed4.50 m/s 2.50–5.30

Cloud cover38.4 % 35.3–51.0

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)