Andinobates opisthomelas

(Boulenger, 1899) · species

image placeholder — illustration coming later

Animalia/Chordata/Amphibia/Anura/Dendrobatidae/Andinobates

At a glance

Occurrence records268

Data sources8

Biological traits7

DNA specimens11

eDNA detections0

Sources8 archives

Databases and archives Andinobates opisthomelas's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility268 records↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Amphibian Species of the WorldAMNHamphibian catalog↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF268 records

DNA & barcodingBOLD11 specimens

Genome at a glanceGoaT2n = 22

01Narrative

The Andean poison frog (Andinobates opisthomelas) is a species of frog in the family Dendrobatidae. It is endemic to Colombia. Its natural habitat is subtropical or tropical moist montane forests. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmphiBIO

Size & morphology1

SVL1.95 cm

Life cycle & reproduction1

Reproductive output1 /year

Diet & foraging1

Arthropodsyes

Habitat & environment2

Habitat arborealyes

Habitat terrestrialyes

Other traits2

Activity diurnalyes

Repro larvalyes

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andinobates opisthomelas has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

79Cmostly conserved

181Cmostly conserved

217Gmostly conserved

229Amostly conserved

238Cmostly conserved

274Amostly conserved

286Tmostly conserved

305Gmostly conserved

319Amostly conserved

460Cmostly conserved

472Cmostly conserved

505Cmostly conserved

508Amostly conserved

544Gmostly conserved

631Gmostly conserved

634Tmostly conserved

646Tmostly conserved

AACCTTATACCTAGTATTCGGGGCTTGAGCCGGAATAGTCGGCACAGCCCTCAGTCTTCTCATTCGAGCAGAATTAAGCCAACCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.70%

Haplotypes7

BIN1

Most divergent pair2.0%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andinobates tolimensissame genus1.8%Andinobates daleswansonisame genus8.8%Andinobates claudiaesame genus13.6%Andinobates minutussame genus14.1%Andinobates fulguritussame genus14.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Andinobates opisthomelas carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Chromosome records22–222n range22median22mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×GoaT · Animal Chromosome Counts Database · GoaT · Amphibian Karyotype Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Amphibian Karyotype Database — ↗

08Occurrence & distribution

Record type268 records

Wild obs. + sensor223

Museum / vouchered45

Origin

Native6

Range

Area of Occupancy AOO612 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy21% within 1 km

≤100 m 36>10 km 132

168 georeferenced · 55 without coordinates

Open the mapobservation + sensor223

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤1 km 1≤10 km 4

5 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence45

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Universidad EAFIT (EAFIT)location not on record	16
Universidad de Antioquia (UdeA)location not on record	13
Universidad de Caldas (UCaldas)location not on record	5
Universidad de La Salle (La Salle)location not on record	3

4 institutions · 37 of 45 vouchered records shown · 8 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)