Andinobates daleswansoni

(Rueda-Almonacid, Rada, Sánchez-Pacheco, Velásquez-Álvarez & Quevedo-Gil, 2006) · species

image placeholder — illustration coming later

Animalia/Chordata/Amphibia/Anura/Dendrobatidae/Andinobates

At a glance

Occurrence records65

Data sources6

Biological traits5

DNA specimens6

eDNA detections0

Sources6 archives

Databases and archives Andinobates daleswansoni's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility65 records↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Amphibian Species of the WorldAMNHamphibian catalog↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF65 records

DNA & barcodingBOLD6 specimens

01Narrative

Andinobates daleswansoni est une espèce d'amphibiens de la famille des Dendrobatidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmphiBIO

Size & morphology1

SVL1.97 cm

Life cycle & reproduction1

Reproductive output2 /year

Habitat & environment1

Habitat terrestrialyes

Other traits2

Activity diurnalyes

Repro larvalyes

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andinobates daleswansoni has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

256Cmostly conserved

343Cmostly conserved

353Gmostly conserved

433Amostly conserved

649Gvariable

AACCTTATACCTAGTATTTGGGGCTTGGGCCGGAATAGTCGGCACAGCCCTCAGTCTACTCATTCGAGCAGAATTAAGCCAACCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.28%

Haplotypes3

BIN1

Most divergent pair0.61%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andinobates virolinensissame genus8.5%Andinobates cassidyhornaesame genus8.7%Andinobates opisthomelassame genus8.8%Andinobates bombetessame genus9.0%Andinobates tolimensissame genus9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type65 records

Wild obs. + sensor60

Museum / vouchered5

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 19>10 km 15

34 georeferenced · 26 without coordinates

Open the mapobservation + sensor60

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Pontificia Universidad Javeriana (PUJ)location not on record	3
Universidad de Caldas (UCaldas)location not on record	1
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	1

3 institutions · 5 of 5 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)