Andinoacara rivulatus

(Günther, 1860) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Cichlidae/Andinoacara

At a glance

Occurrence records232

Data sources11

Biological traits5

DNA specimens33

eDNA detections25

Sources11 archives

Databases and archives Andinoacara rivulatus's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility232 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF232 records

Environmental DNA1 datasets · 2 countries25 detections

DNA & barcodingBOLD33 specimens

Genome at a glanceGoaT · NCBI≈774 Mbp

01Narrative

The green terror (Andinoacara rivulatus, syn. Aequidens rivulatus) is a colorful freshwater fish in the cichlid family. The fish originates from the Pacific side of South America from the Tumbes River in Peru to the Esmeraldas River in Ecuador. It is polymorphic and can have white or gold-orange edging to the tail and dorsal fins. It has historically been confused with two other species that always have narrow, clearly defined white edging, the more southerly distributed A. stalsbergi (often considered the "true" green terror) and the more northerly A. blombergi.Musilova, Rican, and Novak (2009). Phylogeny of the Neotropical cichlid fish tribe Cichlasomatini (Teleostei: Cichlidae) based on morphological and molecular data, with the description of a new genus. Journal of Zoological Systematics and Evolutionary Research 47(3): 209—304.Wijkmark, Kullander, and Barriga (2012). Andinoacara blombergi, a new species from the río Esmeraldas basin in Ecuador and a review of A. rivulatus (Teleostei: Cichlidae). Ichthyological Exploration of Freshwaters 23(2): 117—137.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length20 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importanceof no interest

Other traits1

Vulnerability10

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andinoacara rivulatus has left across the world's sequence archives.

At a glance

DNA specimens33

BINs1

Marker genes11

eDNA detections25

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

104Cmostly conserved

316Amostly conserved

340Gvariable

439Tmostly conserved

539Tmostly conserved

553Tmostly conserved

CCTTTATCTAGTATTTGGTGCCTGGGCCGGAATAGTAGGAACTGCATTAAGCCTGCTAATTCGAGCAGAATTAAGCCAGCCAGGCTCACT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.26%

Haplotypes4

BIN1

Most divergent pair0.46%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andinoacara pulchersame genus10.4%Andinoacara coeruleopunctatussame genus10.7%Andinoacara latifronssame genus11.1%Australoheros minuanosame family14.6%Symphysodon discussame family14.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_025671 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Andinoacara rivulatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈774 398 846 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Andinoacara rivulatus0.77 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

07Deep time~3.61 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin3.61 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type232 records

Wild obs. + sensor79

Museum / vouchered153

Origin

Native1

Range

Area of Occupancy AOO460 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 38≤1 km 17≤10 km 15>10 km 7

77 georeferenced · 2 without coordinates

Open the mapobservation + sensor79

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 1≤10 km 1>10 km 4

6 georeferenced · 147 without coordinates

Open the institutions mapphysical evidence153

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Centro de Investigaciones Biológicas, Universidad Autónoma del Estado de Moreloslocation not on record	111
Toronto, CA	11
Geneva, CH	7
University of Nebraskalocation not on record	4
Chicago, US	4
Museo de Zoología, Universidad Tecnológica Indoamérica (MZUTI)location not on record	3
Ann Arbor, US	2
Texas Cooperative Wildlife Collectionlocation not on record	1
Washington, US	1
Morelia, MX	1
Universidad del Valle (UniValle)location not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
UEMlocation not on record	1
Universidad del Tolima (UT)location not on record	1
Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record	1

15 institutions · 150 of 153 vouchered records shown · 3 without an institution code

09Environmental DNA25 detections

Where the DNA of Andinoacara rivulatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found25

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 25 detections have coordinates

Open the map2 countries0

RiverRiver/Stream

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.9 °C 19.7–25.4

Seasonal swing summer↔winter1.70 °C

Max temp (day)26.1 °C 23.2–26.9

Min temp (night)22.1 °C 16.2–24.2

Precipitation245 mm/mo 151–473

Air humidity72.3 % 68.5–73.0

Moisture balance181 mm/mo

Vapour deficit796 Pa 649–1,014

Wind speed3.90 m/s

Cloud cover60.9 % 42.3–71.8

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)