Andinoacara pulcher

(Gill, 1858) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Cichlidae/Andinoacara

At a glance

Occurrence records1 421

Data sources9

Biological traits5

DNA specimens6

eDNA detections2

Sources9 archives

Databases and archives Andinoacara pulcher's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 421 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF1 421 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD6 specimens

01Narrative

The blue acara (Andinoacara pulcher) is a colorful freshwater fish in the cichlid family."Phylogeny of the Neotropical cichlid fish tribe Cichlasomatini (Teleostei: Cichlidae) based on morphological and molecular data, with the description of a new genus. Journal of Zoological Systematics and Evolutionary Research. Volume 47 Issue 3, Pages 234 - 247." [1] This fish can be found in various freshwater habitats, ranging from standing water to flowing streams, in Venezuela and Trinidad. They can reach lengths of 16 cm. The scientific species name is indicative to its looks; pulcher meaning "beautiful" in Latin. The blue acara is a common cichlid sold in many aquarium stores, and is sometimes confused with the larger green terror (A. rivulatus). The body of the blue acara is stocky and compact with a steel blue-gray coloration. Noticeable horizontal green lines occur on their faces and their blueish-green scales give them a sparkling appearance. They also have long, flowing fins with a hint of orange to the tips. Blue acaras natively live in a tropical climate and prefer water with a pH of 6.5-8.0, a water hardness of 25° dGH, and a water temperature of 22 -."Avila, Marcos A (1997-2008). "Aequidens Pulcher", The Age of Aquariums."[2]"Brough, David (1998-2008). "Aquidens Pulcher, Blue Acara", Dr. Jungle's Animal World."[3]

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length16 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importancecommercial

Other traits1

Vulnerability10

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andinoacara pulcher has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes1

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P625 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

CTAGTATTTGGTGCCTGAGCCGGAATAGTGGGAACTGCACTAAGCCTACTAATTCGAGCAGAACTAAGCCAGCCAGGCTCACTCCTTGGA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andinoacara coeruleopunctatussame genus3.2%Andinoacara rivulatussame genus10.4%Cichla pleiozonasame family13.6%Bujurquina eurhinussame family13.9%Cichla ocellarissame family13.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_033547 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

07Deep time~10.1 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin10.1 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type1 421 records

Wild obs. + sensor622

Museum / vouchered799

Origin

Native7

Range

Area of Occupancy AOO2 640 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 24≤1 km 26≤10 km 2>10 km 4

56 georeferenced · 566 without coordinates

Open the mapobservation + sensor622

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 10≤1 km 112≤10 km 48>10 km 8

178 georeferenced · 621 without coordinates

Open the institutions mapphysical evidence799

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instituto de Biodiversidad de Venezuela - INBIOlocation not on record	466
Universidad del Tolima (UT)location not on record	113
University of Nebraskalocation not on record	88
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	26
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	20
Toronto, CA	16
Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record	15
Pontificia Universidad Javeriana (PUJ)location not on record	15
Texas Cooperative Wildlife Collectionlocation not on record	7
Montgomery, US	5
Universidad de La Salle (La Salle)location not on record	5
FishBaselocation not on record	3
Museums Victorialocation not on record	3
Universidad de Pamplona (UPamplona)location not on record	3
Ann Arbor, US	3
New Haven, US	2
Museo de Ictiología Carlos Arturo Ardila Rodríguez (CAR)location not on record	1
Natick, US	1
Museum and Art Gallery of the Northern Territorylocation not on record	1
Universidad de la Amazonia (UniAmazonia)location not on record	1
Chicago, US	1
Frankfurt am Main	1

22 institutions · 796 of 799 vouchered records shown · 3 without an institution code

09Environmental DNA2 detections

Where the DNA of Andinoacara pulcher was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 25.6–25.6

Seasonal swing summer↔winter3.80 °C

Max temp (day)29.4 °C

Min temp (night)21.8 °C

Precipitation256 mm/mo

Air humidity64.8 %

Moisture balance125 mm/mo

Vapour deficit1,155 Pa

Wind speed1.10 m/s

Cloud cover54.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andinoacara pulcher

At a glance

Sources9 archives

Size & morphology1

Habitat & environment2

Uses & economy1

Other traits1

At a glance

At a glance

When this lineage existed

Record type1 421 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 421 records