Ancylosis morrisonella

Ragonot, 1887 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Ancylosis

At a glance

Occurrence records173

Data sources7

Biological traits0

DNA specimens15

eDNA detections15

Sources7 archives

Databases and archives Ancylosis morrisonella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility173 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF173 records

Environmental DNA1 datasets · 1 countries15 detections

DNA & barcodingBOLD15 specimens

01Narrative

Ancylosis morrisonella, Hodges #5916, Size: 9.2 mm Ancylosis morrisonella is a species of snout moth in the genus Ancylosis. It was described by Émile Louis Ragonot in 1887, and is known from the United States, including Texas, Arizona and Colorado.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylosis morrisonella has left across the world's sequence archives.

At a glance

DNA specimens15

BINs4

Marker genes1

eDNA detections15

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 47 variable positions, in barcode order

55Tmostly conserved

59Tmostly conserved

67Amostly conserved

81Cvariable

91Tmostly conserved

119Avariable

131Gmostly conserved

133Tmostly conserved

163Amostly conserved

200Amostly conserved

202Tmostly conserved

205Avariable

206Tvariable

212Tmostly conserved

220Tvariable

250Tmostly conserved

268Avariable

271Tvariable

277Avariable

283Cvariable

318Cmostly conserved

343Cvariable

364Tmostly conserved

376Avariable

379Avariable

400Cvariable

403Tvariable

407Tmostly conserved

418Tvariable

427Tvariable

428Tmostly conserved

433Avariable

457Tmostly conserved

478Thighly variable

483Cmostly conserved

487Cvariable

508Avariable

541Tmostly conserved

542Tvariable

592Amostly conserved

604Cvariable

616Tvariable

628Amostly conserved

631Amostly conserved

640Tvariable

646Tvariable

653Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGAACTTCTTTAAGTCTTTTAATTCGAGCTGAATTAGGAACTCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.8%

Haplotypes6

BINs4

Most divergent pair4.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancylosis nubeculellasame genus3.0%Ancylosis rhodochrellasame genus4.6%Ancylosis cinnamomellasame genus4.7%Ancylosis hellenicasame genus5.2%Ancylosis samaritanellasame genus5.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type173 records

Wild obs. + sensor65

Museum / vouchered108

Range

Area of Occupancy AOO216 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 21≤1 km 15>10 km 2

38 georeferenced · 27 without coordinates

Open the mapobservation + sensor65

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 4≤1 km 4≤10 km 15>10 km 8

31 georeferenced · 77 without coordinates

Open the institutions mapphysical evidence108

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Oregon State Arthropod Collectionlocation not on record	55
Washington, US	20
New Haven, US	12
San Diego, US	10
San Francisco, US	4
East Lansing, US	4
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
ASUlocation not on record	1

8 institutions · 108 of 108 vouchered records shown

09Environmental DNA15 detections

Where the DNA of Ancylosis morrisonella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 17.1–23.8

Seasonal swing summer↔winter21.9 °C

Max temp (day)29.7 °C 23.7–31.2

Min temp (night)14.2 °C 9.70–15.8

Precipitation7.10 mm/mo 3.20–21.7

Air humidity39.2 % 35.8–42.6

Moisture balance-153 mm/mo -165–-84.7

Vapour deficit1,690 Pa 1,098–1,797

Wind speed2.80 m/s 2.00–3.20

Cloud cover33.5 % 27.1–37.1

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)