Ancylosis cinnamomella

Duponchel, 1836 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Ancylosis

At a glance

Occurrence records1 958

Data sources6

Biological traits0

DNA specimens33

eDNA detections35

Sources6 archives

Databases and archives Ancylosis cinnamomella's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 958 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI35 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 958 records

Environmental DNA1 datasets · 9 countries35 detections

DNA & barcodingBOLD33 specimens

01Narrative

Ancylosis cinnamomella is a species of snout moth in the genus Ancylosis. It was described by Philogène Auguste Joseph Duponchel, in 1836. It is found in most of Europe. The wingspan is about 26 mm. There are two generations per year with adults on wing from April to June and again from July to September. The larvae feed on Sedum acre, Artemisia campestris and Globularia species. They feed from a spinning.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylosis cinnamomella has left across the world's sequence archives.

At a glance

DNA specimens33

BINs4

Marker genes1

eDNA detections35

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

28Amostly conserved

49Tmostly conserved

55Tmostly conserved

106Tmostly conserved

181Amostly conserved

217Gvariable

235Cmostly conserved

271Tmostly conserved

274Tmostly conserved

287Tvariable

385Cvariable

412Tmostly conserved

415Avariable

475Cmostly conserved

533Tmostly conserved

565Tvariable

616Tmostly conserved

625Avariable

634Cvariable

637Tvariable

640Tmostly conserved

646Cvariable

AACATTATATTTTATTTTTGGAATTTGATCAGGAATAATTGGAACTTCTTTAAGTCTTTTAATTCGAGCTGAATTAGGAATTCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes12

BINs4

Most divergent pair2.7%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancylosis morrisonellasame genus4.7%Ancylosis rhodochrellasame genus5.3%Ancylosis hellenicasame genus5.9%Ancylosis convexellasame genus5.9%Ancylosis maculiferasame genus5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 958 records

Wild obs. + sensor1 649

Museum / vouchered250

Other59

Origin

Native15

Range

Area of Occupancy AOO3 440 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 647≤1 km 337≤10 km 156>10 km 23

1 163 georeferenced · 486 without coordinates

Open the mapobservation + sensor1 649

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 40≤1 km 46≤10 km 35>10 km 2

123 georeferenced · 127 without coordinates

Open the institutions mapphysical evidence250

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	38
ZAF-UMUlocation not on record	31
SLU Artdatabankenlocation not on record	23
NHMOlocation not on record	21
Provincia di Livornolocation not on record	20
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	19
Stockholm, SE	18
Tartu, EE	18
European Distributed Institute of Taxonomy (EDIT)location not on record	17
ZSMlocation not on record	5
Adam Mickiewicz University in Poznańlocation not on record	5
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	3
Nijmegen, NL	3
University of Kaiserslauternlocation not on record	2
Helsinki, FI	1
NTNU-VMlocation not on record	1
BioFokuslocation not on record	1
Universite de Montpellierlocation not on record	1
neflocation not on record	1
Uniwersytet Łódzkilocation not on record	1

20 institutions · 229 of 250 vouchered records shown · 21 without an institution code

09Environmental DNA35 detections

Where the DNA of Ancylosis cinnamomella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found35

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 35 detections have coordinates

Open the map9 countries0

Dunes

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 9.20–20.1

Seasonal swing summer↔winter18.9 °C

Max temp (day)20.1 °C 12.7–24.8

Min temp (night)11.2 °C 3.60–15.2

Precipitation63.2 mm/mo 31.9–108

Air humidity58.1 % 53.1–61.7

Moisture balance-36.3 mm/mo

Vapour deficit738 Pa 489–1,029

Wind speed3.00 m/s

Cloud cover35.5 % 32.1–42.7

CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ancylosis cinnamomella

At a glance

Sources6 archives

At a glance

Record type1 958 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 958 records