Ancylis upupana

(Treitschke, 1835) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Ancylis

At a glance

Occurrence records791

Data sources8

Biological traits2

DNA specimens12

eDNA detections12

Sources8 archives

Databases and archives Ancylis upupana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility791 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF791 records

Environmental DNA1 datasets · 4 countries12 detections

DNA & barcodingBOLD12 specimens

01Narrative

Ancylis upupana is a moth of the family Tortricidae. It is found in most of Europe (except Iceland, Ireland, the Iberian Peninsula and most of the Balkan Peninsula), east to Russia and China. The wingspan is 13–20 mm. Adults are on wing from May to June. There is one generation per year. The larvae feed on Ulmus, Betula and Quercus. They spin a folded leaf or multiple leaves together into a pod and feed from within. It partly skeletonises the leaves.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylis upupana has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections12

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

547Gmostly conserved

631Amostly conserved

TACATTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGTAACCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.08%

Haplotypes3

BIN1

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancylis achatanasame genus9.0%Ancylis apicellasame genus9.4%Ancylis braunisame genus9.6%Ophiorrhabda mormopasame family9.7%Larisa subsolanasame family9.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type791 records

Wild obs. + sensor555

Museum / vouchered213

Other23

Range

Area of Occupancy AOO1 724 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 210≤1 km 126≤10 km 180>10 km 4

520 georeferenced · 35 without coordinates

Open the mapobservation + sensor555

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 34≤1 km 130≤10 km 29

193 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence213

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kuopio, FI	56
DanishLepidopterologicalSocietylocation not on record	54
Provincia di Livornolocation not on record	33
Tartu, EE	19
SLU Artdatabankenlocation not on record	7
Salzburg, AT	5
NHMOlocation not on record	3
KIRMlocation not on record	2
Philadelphia, US	2
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	2
Helsinki, FI	1
ZSMlocation not on record	1
Durban Natural Science Museumlocation not on record	1
Nijmegen, NL	1
HUNMlocation not on record	1
Research Collection of Richard Heindellocation not on record	1
University of Kaiserslauternlocation not on record	1
Museum für Naturkunde und Vorgeschichte Dessaulocation not on record	1
Natural History Museum Rotterdamlocation not on record	1

19 institutions · 192 of 213 vouchered records shown · 21 without an institution code

09Environmental DNA12 detections

Where the DNA of Ancylis upupana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.9 °C 13.7–17.1

Seasonal swing summer↔winter19.6 °C

Max temp (day)18.9 °C 18.0–21.1

Min temp (night)10.8 °C 9.00–11.5

Precipitation92.8 mm/mo 59.6–152

Air humidity59.7 % 57.9–61.8

Moisture balance-13.7 mm/mo -47.7–44.7

Vapour deficit714 Pa 611–805

Wind speed3.10 m/s 2.10–3.70

Cloud cover36.2 % 33.2–46.6

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)