Ancistrus temminckii

(Valenciennes, 1840) · species

image placeholder — illustration coming later

Animalia/Chordata/Siluriformes/Loricariidae/Ancistrus

At a glance

Occurrence records306

Data sources7

Biological traits5

DNA specimens15

eDNA detections15

Sources7 archives

Databases and archives Ancistrus temminckii's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility306 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF306 records

Environmental DNA2 datasets · 3 countries15 detections

DNA & barcodingBOLD15 specimens

01Narrative

Ancistrus temminckii is a species of armoured suckermouth catfish in the family Loricariidae of order Siluriformes. It is found in Suriname in the Saramacca River, Suriname River and Maroni River basins. Males grow to about 10 cm excluding tail. It is very rarely imported these days, however individuals of the so-called Ancistrus cf. cirrhosus, a fish of which the origin is unknown, are often sold as A. temminckii. The difference between the two species is that the A. temminckii has a dark spot at the base of its dorsal fin, between the first and the second ray.PlanetCatfish: http://www.planetcatfish.com/ancistrus_temminckii , visited on 10 April 2018

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length9.8 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonedemersal

Uses & economy1

Commercial importancecommercial

Other traits1

Vulnerability10

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancistrus temminckii has left across the world's sequence archives.

At a glance

DNA specimens15

BINs3

Marker genes1

eDNA detections15

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P632 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 85 variable positions, in barcode order

1Amostly conserved

3Gmostly conserved

5Tmostly conserved

7Gmostly conserved

8Gmostly conserved

9Tmostly conserved

10Amostly conserved

12Amostly conserved

13Gmostly conserved

14Cmostly conserved

33Gmostly conserved

69Tmostly conserved

75Gmostly conserved

78Cmostly conserved

138Tmostly conserved

168Cmostly conserved

177Amostly conserved

183Gmostly conserved

186Gmostly conserved

189Cmostly conserved

192Cmostly conserved

198Cmostly conserved

216Cmostly conserved

219Amostly conserved

231Gmostly conserved

234Cmostly conserved

240Tmostly conserved

252Cvariable

253Tmostly conserved

255Gmostly conserved

256Tmostly conserved

258Amostly conserved

264Cmostly conserved

279Tmostly conserved

282Gmostly conserved

285Amostly conserved

288Amostly conserved

291Amostly conserved

306Tmostly conserved

309Cmostly conserved

312Cmostly conserved

315Tmostly conserved

324Cmostly conserved

325Tmostly conserved

327Amostly conserved

333Cmostly conserved

339Gmostly conserved

345Amostly conserved

348Tmostly conserved

354Amostly conserved

360Cmostly conserved

369Amostly conserved

375Amostly conserved

384Gmostly conserved

393Tmostly conserved

396Amostly conserved

414Tmostly conserved

417Tmostly conserved

423Tmostly conserved

426Tmostly conserved

432Gmostly conserved

435Amostly conserved

441Amostly conserved

447Tmostly conserved

462Cmostly conserved

465Cmostly conserved

466Tmostly conserved

468Gmostly conserved

477Gmostly conserved

480Tmostly conserved

489Gmostly conserved

498Amostly conserved

501Gmostly conserved

522Cmostly conserved

525Amostly conserved

528Tmostly conserved

534Tvariable

546Amostly conserved

549Amostly conserved

561Cmostly conserved

567Tmostly conserved

588Amostly conserved

594Gmostly conserved

609Amostly conserved

627Amostly conserved

ATGGTTGGTACAGCCCTCAGTCTCTTAATTCGGGCTGAGTTAAGCCAACCCGGTTCTCTATTAGGTGATGACCAGATCTATAATGTCATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.2%

Haplotypes4

BINs3

Most divergent pair9.0%

S.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancistrus maldonadoisame genus4.7%Ancistrus hoplogenyssame genus4.8%Ancistrus marcapataesame genus5.5%Ancistrus multispinissame genus6.1%Ancistrus cirrhosussame genus6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_051963 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type306 records

Wild obs. + sensor163

Museum / vouchered134

Other9

Range

Area of Occupancy AOO716 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy1% within 1 km

≤100 m 1>10 km 70

71 georeferenced · 92 without coordinates

Open the mapobservation + sensor163

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤1 km 2≤10 km 29>10 km 13

44 georeferenced · 90 without coordinates

Open the institutions mapphysical evidence134

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Geneva, CH	54
CASlocation not on record	35
Washington, US	11
Cambridge, US	6
Chicago, US	6
Toronto, CA	5
FishBaselocation not on record	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Champaign, US	3
ARMS-MBONlocation not on record	2
Paris, FR	1
RBINS-Scientific Heritagelocation not on record	1
Ann Arbor, US	1
Brussels, BE	1
Museo de Historia Natural “Gustavo Orcés V"location not on record	1

15 institutions · 134 of 134 vouchered records shown

09Environmental DNA15 detections

Where the DNA of Ancistrus temminckii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys2

Countries3

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map3 countries0

FreshwaterMarine Protected Area; protected; 9.2 - Subt…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.6 °C 14.5–27.2

Seasonal swing summer↔winter2.40 °C

Max temp (day)32.0 °C 16.8–33.0

Min temp (night)22.5 °C 10.5–22.5

Precipitation66.4 mm/mo 52.8–106

Air humidity60.7 % 56.7–65.1

Moisture balance-91.3 mm/mo -116–-13.0

Vapour deficit1,296 Pa 658–1,559

Wind speed1.30 m/s 1.30–3.30

Cloud cover32.9 % 31.8–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)