Ancistrus marcapatae — The Life Data

Animalia/Chordata/Siluriformes/Loricariidae/Ancistrus

At a glance

Occurrence records13

Data sources7

Biological traits5

DNA specimens25

eDNA detections0

Sources7 archives

Databases and archives Ancistrus marcapatae's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility13 records↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF13 records

DNA & barcodingBOLD25 specimens

01Narrative

Ancistrus marcapatae is a species of catfish in the family Loricariidae. It is native to South America, where it occurs in the Inambari River basin, which is part of the Madeira River drainage in Peru. The species reaches 12.4 cm (4.9 inches) in total length.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length12.4 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonedemersal

Uses & economy1

Commercial importanceof no interest

Other traits1

Vulnerability10

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancistrus marcapatae has left across the world's sequence archives.

At a glance

DNA specimens25

BINs1

Marker genes2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

340Amostly conserved

578Cmostly conserved

CCTTTACCTAGTGTTTGGTGCTTGAGCCGGAATAATTGGTACAGCCCTCAGTCTCTTAATTCGAGCTGAGCTAAGCCAACCCGGTTCTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.09%

Haplotypes4

BIN1

Most divergent pair0.46%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancistrus maldonadoisame genus5.4%Ancistrus temminckiisame genus5.5%Ancistrus hoplogenyssame genus5.5%Ancistrus cirrhosussame genus7.2%Ancistrus aguaboensissame genus7.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P12S

animal barcodemarker

08Occurrence & distribution

Record type13 records

Museum / vouchered13

Range

Area of Occupancy AOO48 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 13 records without

Open the institutions mapphysical evidence13

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Montgomery, US	7
Ann Arbor, US	4
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	1
Toronto, CA	1

4 institutions · 13 of 13 vouchered records shown