Ancistrus cryptophthalmus

Reis, 1987 · species

image placeholder — illustration coming later

Animalia/Chordata/Siluriformes/Loricariidae/Ancistrus

At a glance

Occurrence records19

Data sources8

Biological traits5

DNA specimens17

eDNA detections29

Sources8 archives

Databases and archives Ancistrus cryptophthalmus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility19 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF19 records

Environmental DNA1 datasets · 0 countries29 detections

DNA & barcodingBOLD17 specimens

01Narrative

Ancistrus cryptophthalmus is a species of catfish in the family Loricariidae. It is a stygobitic species that is native to South America and occurs only in the São Vicente and Angélica-Bezerra cave system in the Paranã River basin, which is part of the Tocantins River drainage in Brazil. The species reaches 6 cm (2.4 inches) SL. Alongside Ancistrus galani and A. formoso, this species displays characteristics unusual among loricariids, such as reduced pigmentation and atrophied eyes, which are adaptations to a subterranean habitat that can be found in various types of cavefish.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length6 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importanceof no interest

Other traits1

Vulnerability10

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancistrus cryptophthalmus has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes1

eDNA detections29

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P556 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

385Gmostly conserved

521Tmostly conserved

CCCTCAGTCTCTTGATTCGAGCTGAGTTAAGCCAACCCGGTTCTCTATTAGGTGATGATCAGATTTATAATGTCATCGTTACCGCACATG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.06%

Haplotypes3

BIN1

Most divergent pair0.36%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancistrus cirrhosussame genus5.4%Ancistrus multispinissame genus5.7%Ancistrus aguaboensissame genus7.2%Ancistrus temminckiisame genus7.4%Ancistrus hoplogenyssame genus8.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type19 records

Museum / vouchered15

Other4

Range

Area of Occupancy AOO36 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence15

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museu de Zoologia da Universidade de Sao Paulolocation not on record	6
PUC-RSlocation not on record	6
FishBaselocation not on record	1
Brussels, BE	1
RBINS-Scientific Heritagelocation not on record	1

5 institutions · 15 of 15 vouchered records shown

09Environmental DNA29 detections

Where the DNA of Ancistrus cryptophthalmus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)