Ancistroides nigrita

(Latreille, 1824) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hesperiidae/Ancistroides

At a glance

Occurrence records532

Data sources7

Biological traits0

DNA specimens27

eDNA detections36

Sources7 archives

Databases and archives Ancistroides nigrita's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility532 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF532 records

Environmental DNA1 datasets · 5 countries36 detections

DNA & barcodingBOLD27 specimens

01Narrative

Ancistroides nigrita, the chocolate demon, is a butterfly belonging to the family Hesperiidae. upright

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancistroides nigrita has left across the world's sequence archives.

At a glance

DNA specimens27

BINs6

Marker genes2

eDNA detections36

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Where individuals differ — all 108 variable positions, in barcode order

1Cvariable

4Tmostly conserved

28Amostly conserved

34Tmostly conserved

38Tmostly conserved

50Tmostly conserved

52Amostly conserved

55Amostly conserved

56Tmostly conserved

58Avariable

59Tmostly conserved

61Amostly conserved

67Gvariable

70Cvariable

79Amostly conserved

81Amostly conserved

85Cvariable

101Gmostly conserved

106Tmostly conserved

130Amostly conserved

133Cvariable

163Tmostly conserved

169Amostly conserved

184Amostly conserved

197Cvariable

202Tmostly conserved

205Cmostly conserved

206Cvariable

212Cvariable

217Cvariable

223Tmostly conserved

226Cmostly conserved

229Amostly conserved

238Cvariable

241Tvariable

247Cvariable

256Tmostly conserved

263Cmostly conserved

265Tmostly conserved

266Tmostly conserved

268Gvariable

274Tmostly conserved

277Cmostly conserved

278Tmostly conserved

283Tmostly conserved

286Tmostly conserved

287Tmostly conserved

304Cmostly conserved

316Tvariable

319Tmostly conserved

325Avariable

328Amostly conserved

334Tvariable

337Tmostly conserved

346Cvariable

347Cmostly conserved

349Cvariable

352Amostly conserved

361Cvariable

364Cvariable

367Tvariable

376Tvariable

379Tmostly conserved

385Tvariable

386Tmostly conserved

400Cmostly conserved

401Cvariable

403Cvariable

407Cvariable

409Tvariable

412Avariable

433Amostly conserved

436Amostly conserved

451Amostly conserved

463Tmostly conserved

478Cvariable

483Cmostly conserved

484Cvariable

490Tmostly conserved

500Tmostly conserved

508Tmostly conserved

517Amostly conserved

520Amostly conserved

523Tmostly conserved

529Tmostly conserved

536Tmostly conserved

538Amostly conserved

542Cmostly conserved

544Tmostly conserved

547Tmostly conserved

548Cmostly conserved

562Tmostly conserved

565Amostly conserved

581Cmostly conserved

583Amostly conserved

586Amostly conserved

589Tmostly conserved

604Tmostly conserved

607Tmostly conserved

610Tmostly conserved

616Tmostly conserved

628Avariable

634Cmostly conserved

637Amostly conserved

646Cvariable

649Amostly conserved

652Cmostly conserved

653Tmostly conserved

CACTTTATATTTTATTTTTGGAATTTGAGCAGGTATATTAGGAACATCTTTAAGATTATTAATTCGGACCGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)6.1%

Haplotypes5

BINs6

Most divergent pair12.8%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Notocrypta clavatasame family9.0%Notocrypta paralysossame family9.1%Pyrrhocalles antiquasame family10.7%Ypthima asteropesame order11.0%Antheua simplexsame order11.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type532 records

Wild obs. + sensor472

Museum / vouchered60

Range

Area of Occupancy AOO1 164 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 135≤1 km 174≤10 km 55>10 km 29

393 georeferenced · 79 without coordinates

Open the mapobservation + sensor472

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤1 km 7≤10 km 14>10 km 11

32 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence60

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	12
Helsinki, FI	5
Auckland, NZ	5
Natural History Museum, Tribhuvan Universitylocation not on record	4
Durban Natural Science Museumlocation not on record	2
Zürich, CH	2
MZLUlocation not on record	2
New Haven, US	1
Smithsonian Tropical Research Institute, Center for Tropical Forest Science, Khao Chong, Arthropod Laboratorylocation not on record	1
University of Malaya, Museum of Zoologylocation not on record	1

10 institutions · 35 of 60 vouchered records shown · 23 without an institution code

09Environmental DNA36 detections

Where the DNA of Ancistroides nigrita was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map5 countries0

1. Forest & Woodland | 1.5. Subtropical/Trop…Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.2 °C 21.7–27.4

Seasonal swing summer↔winter2.00 °C

Max temp (day)28.7 °C 24.4–30.8

Min temp (night)22.5 °C 18.4–24.8

Precipitation238 mm/mo 50.4–382

Air humidity68.2 % 60.6–71.3

Moisture balance105 mm/mo -49.7–348

Vapour deficit1,126 Pa 773–1,232

Wind speed1.90 m/s 0.9–3.70

Cloud cover41.4 % 18.5–67.4

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)