Antheua simplex

Walker, 1855 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Notodontidae/Antheua

At a glance

Occurrence records38

Data sources6

Biological traits0

DNA specimens3

eDNA detections5

Sources6 archives

Databases and archives Antheua simplex's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility38 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF38 records

Environmental DNA1 datasets · 4 countries5 detections

DNA & barcodingBOLD3 specimens

01Narrative

Antheua simplex is een vlinder uit de familie tandvlinders (Notodontidae). De wetenschappelijke naam van deze soort is voor het eerst geldig gepubliceerd in 1855 door Walker. De soort komt voor in tropisch Afrika.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antheua simplex has left across the world's sequence archives.

At a glance

DNA specimens3

BINs2

Marker genes1

eDNA detections5

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)1.7%

Haplotypes2

BINs2

Most divergent pair2.3%

Where individuals differ — all 16 variable positions, in barcode order

46Cvariable

157Tvariable

214Avariable

220Cvariable

334Avariable

340Tvariable

364Tvariable

370Avariable

406Cvariable

466Avariable

469Tvariable

478Cvariable

517Avariable

547Cvariable

622Avariable

646Cvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCATTAAGATTATTAATTCGAGCAGAATTAGGAACTCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phalera lydenburgisame family4.9%Datana perspicuasame family5.5%Antheua tricolorsame genus5.5%Datana angusiisame family5.6%Datana neomexicanasame family5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type38 records

Wild obs. + sensor18

Museum / vouchered20

Range

Area of Occupancy AOO112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 8≤1 km 1≤10 km 1

10 georeferenced · 8 without coordinates

Open the mapobservation + sensor18

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 2≤10 km 4>10 km 2

8 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	7
Durban Natural Science Museumlocation not on record	3
Helsinki, FI	2
East Lansing, US	2

4 institutions · 14 of 20 vouchered records shown · 6 without an institution code

09Environmental DNA5 detections

Where the DNA of Antheua simplex was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.2 °C 19.7–21.0

Seasonal swing summer↔winter4.40 °C

Max temp (day)25.1 °C 24.7–26.1

Min temp (night)15.2 °C 14.7–16.1

Precipitation110 mm/mo 76.9–218

Air humidity57.7 % 54.7–66.5

Moisture balance-28.7 mm/mo -77.9–80.9

Vapour deficit979 Pa 777–1,131

Wind speed2.90 m/s 2.10–3.50

Cloud cover31.9 % 28.6–56.1

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)