Anchovia clupeoides

(Swainson, 1839) · species

image placeholder — illustration coming later

Animalia/Chordata/Clupeiformes/Engraulidae/Anchovia

At a glance

Occurrence records157 806

Data sources9

Biological traits8

DNA specimens51

eDNA detections45

Sources9 archives

Databases and archives Anchovia clupeoides's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility78 987 records↗

OBISOcean Biodiversity Information System78 819 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI45 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics51 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources8 traits

Occurrence & distributionGBIF · OBIS157 806 records

Environmental DNA1 datasets · 1 countries45 detections

DNA & barcodingBOLD51 specimens

01Narrative

Anchovia clupeoides is een straalvinnige vis uit de familie van ansjovissen (Engraulidae), orde van haringachtigen (Clupeiformes). De vis kan een lengte bereiken van 30 centimeter.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length30 cm

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importanceminor commercial

Other traits3

Depth max50 m

Depth min0 m

Vulnerability20

05DNA & barcoding51 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anchovia clupeoides has left across the world's sequence archives.

At a glance

DNA specimens51

BINs2

Marker genes1

eDNA detections45

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P648 bp consensus51 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Diversity (π)3.3%

Haplotypes2

BINs2

Most divergent pair0.15%

Where individuals differ — all 88 variable positions, in barcode order

71Tmostly conserved

76Tmostly conserved

82Amostly conserved

85Amostly conserved

88Amostly conserved

94Gmostly conserved

100Cmostly conserved

103Cmostly conserved

106Gmostly conserved

118Amostly conserved

124Amostly conserved

127Cmostly conserved

130Cmostly conserved

145Amostly conserved

148Cmostly conserved

151Tmostly conserved

154Tmostly conserved

157Gmostly conserved

160Gmostly conserved

169Tmostly conserved

170Amostly conserved

175Tmostly conserved

178Cmostly conserved

181Cmostly conserved

187Gmostly conserved

199Cmostly conserved

205Tmostly conserved

208Amostly conserved

211Amostly conserved

235Tmostly conserved

247Cmostly conserved

250Gmostly conserved

256Tmostly conserved

268Cmostly conserved

271Cmostly conserved

277Cmostly conserved

280Gmostly conserved

283Tmostly conserved

289Gmostly conserved

298Tmostly conserved

301Gmostly conserved

310Cmostly conserved

316Tmostly conserved

319Gmostly conserved

328Gmostly conserved

334Tmostly conserved

346Amostly conserved

349Amostly conserved

352Cmostly conserved

356Cmostly conserved

358Tmostly conserved

367Cmostly conserved

376Gmostly conserved

385Gmostly conserved

391Cmostly conserved

394Tmostly conserved

397Tmostly conserved

404Tmostly conserved

406Amostly conserved

415Cmostly conserved

424Tmostly conserved

436Tmostly conserved

439Tmostly conserved

442Tmostly conserved

448Cmostly conserved

457Cmostly conserved

460Tmostly conserved

463Amostly conserved

475Cmostly conserved

490Gmostly conserved

497Tmostly conserved

499Amostly conserved

514Gmostly conserved

515Cmostly conserved

517Tmostly conserved

538Gmostly conserved

550Cmostly conserved

565Gmostly conserved

580Tmostly conserved

604Tmostly conserved

610Tmostly conserved

613Tmostly conserved

616Amostly conserved

622Gmostly conserved

625Amostly conserved

628Amostly conserved

631Cmostly conserved

634Gmostly conserved

CCTATATCTTGTCTTCGGTGCCTGAGCAGGAATGGTGGGAACAGCACTCAGCCTCCTTATTCGAGCAGAATTAAGTCAACCAGGAGCACT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anchoa ischanasame family10.0%Anchoa mariniisame family10.5%Anchoa hepsetussame family10.8%Engraulis encrasicolussame family10.8%Engraulis japonicussame family11.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type157 806 records

Wild obs. + sensor157 580

Museum / vouchered219

Other7

Origin

Native5

Range

Area of Occupancy AOO1 512 km²

Depth

0–200 m sunlit2

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 4.3 m · max 5 m · 2 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy3% within 1 km

≤100 m 3≤10 km 59>10 km 27

89 georeferenced · 157 491 without coordinates

Open the mapobservation + sensor157 580

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤100 m 3≤1 km 5≤10 km 27>10 km 17

52 georeferenced · 167 without coordinates

Open the institutions mapphysical evidence219

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
INMAlocation not on record	13
Museu de Zoologia da Universidade de Sao Paulolocation not on record	10
UFESlocation not on record	9
CASlocation not on record	9
Ann Arbor, US	9
Cambridge, US	7
Chicago, US	7
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
University of Nebraskalocation not on record	4
Universidad de Antioquia (UdeA)location not on record	3
Washington, US	3
Louisiana State University, Museum of Zoologylocation not on record	3
University of California San Diegolocation not on record	2
Los Angeles, US	2
North Carolina Museum of Natural Scienceslocation not on record	2
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	2
Tapachula, MX	2
UNICAMPlocation not on record	2
Geneva, CH	1
Toronto, CA	1
Universidad de La Salle (La Salle)location not on record	1
Stockholm, SE	1
Universidad del Valle de Guatemalalocation not on record	1
Paris, FR	1
El Colegio de la Frontera Sur, Unidad Chetumallocation not on record	1
Helsinki, FI	1
PUC-RSlocation not on record	1
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	1

28 institutions · 103 of 219 vouchered records shown · 15 without an institution code

09Environmental DNA45 detections

Where the DNA of Anchovia clupeoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found45

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 45 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.0 °C 24.4–27.6

Seasonal swing summer↔winter4.60 °C

Max temp (day)30.4 °C 27.9–31.5

Min temp (night)23.6 °C 21.4–24.7

Precipitation102 mm/mo 38.2–211

Air humidity64.0 % 60.0–65.9

Moisture balance-30.5 mm/mo -131–42.8

Vapour deficit1,260 Pa 1,084–1,408

Wind speed2.10 m/s 1.60–3.00

Cloud cover28.6 % 21.6–33.0

CHELSA 1981–2010, ~9 km grid, at location & month of 44 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anchovia clupeoides

At a glance

Sources9 archives

Size & morphology1

Habitat & environment3

Uses & economy1

Other traits3

At a glance

Record type157 806 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type157 806 records